Mutagenetix > Incidental Mutation

Incidental Mutation 'R6316:Xrn2'

509973

Institutional Source

Beutler Lab

Gene Symbol

Xrn2

Ensembl Gene

ENSMUSG00000027433

Gene Name

5'-3' exoribonuclease 2

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R6316 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

147012996-147078000 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 147042010 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 563 (Y563C)

Ref Sequence

ENSEMBL: ENSMUSP00000028921 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028921]

AlphaFold

Q9DBR1

Predicted Effect

probably damaging
Transcript: ENSMUST00000028921
AA Change: Y563C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028921
Gene: ENSMUSG00000027433
AA Change: Y563C

Domain	Start	End	E-Value	Type
Pfam:XRN_N	1	254	1.5e-104	PFAM
ZnF_C2HC	262	278	7.99e-1	SMART
low complexity region	415	427	N/A	INTRINSIC
PDB:3FQD\|A	469	785	8e-75	PDB
low complexity region	913	932	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136136

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147057

Meta Mutation Damage Score

0.8768

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 98.0%

Validation Efficiency

97% (38/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 5'-3' exonuclease that promotes transcription termination at cotranscriptional cleavage sites. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,313,959	T775A	probably benign	Het
Adam6a	A	T	12: 113,545,576	N523I	probably benign	Het
Adgrv1	T	C	13: 81,499,068	T3118A	possibly damaging	Het
Arhgef4	G	A	1: 34,723,477	A605T	unknown	Het
Asxl3	A	G	18: 22,522,782	Y1283C	probably damaging	Het
BC005561	G	C	5: 104,519,729	G706R	probably damaging	Het
Btbd2	T	A	10: 80,644,778	I319F	probably damaging	Het
Eno4	G	A	19: 58,960,291		probably null	Het
Glis2	T	A	16: 4,613,836		probably benign	Het
Grin2b	A	T	6: 135,780,279	C395S	probably benign	Het
H1foo	T	C	6: 115,948,915		probably null	Het
Kansl1l	T	A	1: 66,735,585	Y694F	probably benign	Het
Kcnj1	A	T	9: 32,397,336	E332V	probably damaging	Het
Klhdc7a	T	C	4: 139,966,802	E278G	probably benign	Het
Krt33a	T	C	11: 100,014,201	N160D	probably damaging	Het
Ksr2	A	G	5: 117,685,502	N448S	probably damaging	Het
Lpar6	A	G	14: 73,239,334	Y245C	probably damaging	Het
Magel2	T	C	7: 62,378,719	I457T	possibly damaging	Het
Manf	A	G	9: 106,889,186	L132P	probably damaging	Het
Moxd2	T	C	6: 40,883,547	D321G	probably damaging	Het
Mtmr12	T	A	15: 12,236,113	C153S	probably null	Het
Muc16	T	C	9: 18,641,819	T4393A	probably benign	Het
Notch3	T	C	17: 32,137,813		probably null	Het
Olfr311	A	G	11: 58,841,942	Y276C	probably damaging	Het
Pirb	T	A	7: 3,717,823	K225N	probably damaging	Het
Plch1	C	T	3: 63,781,390	W131*	probably null	Het
Rilpl2	A	G	5: 124,477,880	V69A	probably damaging	Het
Smdt1	T	C	15: 82,348,009	V99A	probably damaging	Het
Smpd1	T	C	7: 105,555,502	V196A	probably benign	Het
Supt20	TCAGCAGCAGCAGCAGCAGCAGCA	TCAGCAGCAGCAGCAGCAGCAGCAGCA	3: 54,727,648		probably benign	Het
Tcte1	A	G	17: 45,534,860	H130R	probably benign	Het
Tead1	C	A	7: 112,891,839	Q296K	probably damaging	Het
Tmem163	C	T	1: 127,551,365	S139N	probably benign	Het
Tor1aip2	G	T	1: 156,062,094	D192Y	probably damaging	Het
Trgv2	G	A	13: 19,336,742	Q61*	probably null	Het
Trib1	T	C	15: 59,649,415	S85P	probably benign	Het
Trrap	T	A	5: 144,813,526	N1581K	probably benign	Het
Vmn1r181	G	A	7: 23,984,758	R216Q	probably benign	Het

Other mutations in Xrn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Xrn2	APN	2	147036750	missense	probably benign	0.00
IGL00950:Xrn2	APN	2	147028146	nonsense	probably null
IGL01323:Xrn2	APN	2	147034847	splice site	probably benign
IGL01328:Xrn2	APN	2	147029930	missense	possibly damaging	0.90
IGL01545:Xrn2	APN	2	147038179	missense	probably benign
IGL01729:Xrn2	APN	2	147036797	critical splice donor site	probably null
IGL01805:Xrn2	APN	2	147028143	missense	probably damaging	0.98
IGL02326:Xrn2	APN	2	147047713	missense	probably benign	0.32
IGL02332:Xrn2	APN	2	147026590	missense	probably damaging	1.00
IGL02556:Xrn2	APN	2	147038296	splice site	probably benign
IGL02609:Xrn2	APN	2	147050025	missense	probably benign	0.00
IGL02941:Xrn2	APN	2	147026524	missense	probably damaging	1.00
IGL03119:Xrn2	APN	2	147042872	missense	probably damaging	1.00
R0052:Xrn2	UTSW	2	147040965	splice site	probably benign
R0114:Xrn2	UTSW	2	147029779	missense	probably damaging	0.98
R0196:Xrn2	UTSW	2	147047660	missense	probably damaging	0.99
R0799:Xrn2	UTSW	2	147029898	missense	probably benign	0.03
R0991:Xrn2	UTSW	2	147042082	missense	probably benign	0.40
R1444:Xrn2	UTSW	2	147061488	missense	probably damaging	0.99
R1727:Xrn2	UTSW	2	147061516	missense	probably benign	0.00
R1735:Xrn2	UTSW	2	147061423	missense	probably damaging	1.00
R1885:Xrn2	UTSW	2	147049361	nonsense	probably null
R2199:Xrn2	UTSW	2	147024750	missense	probably damaging	0.96
R2884:Xrn2	UTSW	2	147047656	missense	probably damaging	1.00
R3730:Xrn2	UTSW	2	147024809	missense	probably benign	0.09
R3771:Xrn2	UTSW	2	147061287	missense	probably benign	0.12
R3772:Xrn2	UTSW	2	147061287	missense	probably benign	0.12
R3773:Xrn2	UTSW	2	147061287	missense	probably benign	0.12
R3816:Xrn2	UTSW	2	147028200	missense	probably damaging	1.00
R3927:Xrn2	UTSW	2	147038189	missense	probably benign
R4173:Xrn2	UTSW	2	147047692	missense	probably damaging	0.96
R4659:Xrn2	UTSW	2	147061474	missense	probably benign	0.01
R4928:Xrn2	UTSW	2	147051718	missense	possibly damaging	0.80
R5452:Xrn2	UTSW	2	147024713	critical splice acceptor site	probably null
R5527:Xrn2	UTSW	2	147029755	missense	probably benign	0.02
R6297:Xrn2	UTSW	2	147026570	missense	probably damaging	1.00
R6301:Xrn2	UTSW	2	147063342	missense	probably benign	0.05
R6705:Xrn2	UTSW	2	147036662	critical splice acceptor site	probably null
R7173:Xrn2	UTSW	2	147042093	missense	probably damaging	1.00
R7408:Xrn2	UTSW	2	147042097	critical splice donor site	probably null
R7412:Xrn2	UTSW	2	147049346	missense	probably damaging	0.99
R7501:Xrn2	UTSW	2	147029756	missense	probably damaging	1.00
R7856:Xrn2	UTSW	2	147068473	splice site	probably null
R8912:Xrn2	UTSW	2	147049993	missense	probably benign	0.04
R8969:Xrn2	UTSW	2	147029384	missense	probably damaging	1.00
R9083:Xrn2	UTSW	2	147038279	missense	probably damaging	1.00
R9179:Xrn2	UTSW	2	147013161	missense	probably benign	0.04
Z1177:Xrn2	UTSW	2	147028206	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- ACCACTGATATGAAGCAGACAG -3'
(R):5'- ACTTGCAGCTGGGAAAACC -3'

Sequencing Primer
(F):5'- ATGAGTGGAGTATATGCCA -3'
(R):5'- GAAAACCCCCATTAGTTGTTCCAGTG -3'

Posted On

2018-04-02