Incidental Mutation 'R6316:Xrn2'
ID509973
Institutional Source Beutler Lab
Gene Symbol Xrn2
Ensembl Gene ENSMUSG00000027433
Gene Name5'-3' exoribonuclease 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R6316 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location147012996-147078000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 147042010 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 563 (Y563C)
Ref Sequence ENSEMBL: ENSMUSP00000028921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028921]
Predicted Effect probably damaging
Transcript: ENSMUST00000028921
AA Change: Y563C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028921
Gene: ENSMUSG00000027433
AA Change: Y563C

DomainStartEndE-ValueType
Pfam:XRN_N 1 254 1.5e-104 PFAM
ZnF_C2HC 262 278 7.99e-1 SMART
low complexity region 415 427 N/A INTRINSIC
PDB:3FQD|A 469 785 8e-75 PDB
low complexity region 913 932 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147057
Meta Mutation Damage Score 0.8768 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 5'-3' exonuclease that promotes transcription termination at cotranscriptional cleavage sites. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,313,959 T775A probably benign Het
Adam6a A T 12: 113,545,576 N523I probably benign Het
Adgrv1 T C 13: 81,499,068 T3118A possibly damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Asxl3 A G 18: 22,522,782 Y1283C probably damaging Het
BC005561 G C 5: 104,519,729 G706R probably damaging Het
Btbd2 T A 10: 80,644,778 I319F probably damaging Het
Eno4 G A 19: 58,960,291 probably null Het
Glis2 T A 16: 4,613,836 probably benign Het
Grin2b A T 6: 135,780,279 C395S probably benign Het
H1foo T C 6: 115,948,915 probably null Het
Kansl1l T A 1: 66,735,585 Y694F probably benign Het
Kcnj1 A T 9: 32,397,336 E332V probably damaging Het
Klhdc7a T C 4: 139,966,802 E278G probably benign Het
Krt33a T C 11: 100,014,201 N160D probably damaging Het
Ksr2 A G 5: 117,685,502 N448S probably damaging Het
Lpar6 A G 14: 73,239,334 Y245C probably damaging Het
Magel2 T C 7: 62,378,719 I457T possibly damaging Het
Manf A G 9: 106,889,186 L132P probably damaging Het
Moxd2 T C 6: 40,883,547 D321G probably damaging Het
Mtmr12 T A 15: 12,236,113 C153S probably null Het
Muc16 T C 9: 18,641,819 T4393A probably benign Het
Notch3 T C 17: 32,137,813 probably null Het
Olfr311 A G 11: 58,841,942 Y276C probably damaging Het
Pirb T A 7: 3,717,823 K225N probably damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Rilpl2 A G 5: 124,477,880 V69A probably damaging Het
Smdt1 T C 15: 82,348,009 V99A probably damaging Het
Smpd1 T C 7: 105,555,502 V196A probably benign Het
Supt20 TCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCAGCA 3: 54,727,648 probably benign Het
Tcte1 A G 17: 45,534,860 H130R probably benign Het
Tead1 C A 7: 112,891,839 Q296K probably damaging Het
Tmem163 C T 1: 127,551,365 S139N probably benign Het
Tor1aip2 G T 1: 156,062,094 D192Y probably damaging Het
Trgv2 G A 13: 19,336,742 Q61* probably null Het
Trib1 T C 15: 59,649,415 S85P probably benign Het
Trrap T A 5: 144,813,526 N1581K probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Other mutations in Xrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Xrn2 APN 2 147036750 missense probably benign 0.00
IGL00950:Xrn2 APN 2 147028146 nonsense probably null
IGL01323:Xrn2 APN 2 147034847 splice site probably benign
IGL01328:Xrn2 APN 2 147029930 missense possibly damaging 0.90
IGL01545:Xrn2 APN 2 147038179 missense probably benign
IGL01729:Xrn2 APN 2 147036797 critical splice donor site probably null
IGL01805:Xrn2 APN 2 147028143 missense probably damaging 0.98
IGL02326:Xrn2 APN 2 147047713 missense probably benign 0.32
IGL02332:Xrn2 APN 2 147026590 missense probably damaging 1.00
IGL02556:Xrn2 APN 2 147038296 splice site probably benign
IGL02609:Xrn2 APN 2 147050025 missense probably benign 0.00
IGL02941:Xrn2 APN 2 147026524 missense probably damaging 1.00
IGL03119:Xrn2 APN 2 147042872 missense probably damaging 1.00
R0052:Xrn2 UTSW 2 147040965 splice site probably benign
R0114:Xrn2 UTSW 2 147029779 missense probably damaging 0.98
R0196:Xrn2 UTSW 2 147047660 missense probably damaging 0.99
R0799:Xrn2 UTSW 2 147029898 missense probably benign 0.03
R0991:Xrn2 UTSW 2 147042082 missense probably benign 0.40
R1444:Xrn2 UTSW 2 147061488 missense probably damaging 0.99
R1727:Xrn2 UTSW 2 147061516 missense probably benign 0.00
R1735:Xrn2 UTSW 2 147061423 missense probably damaging 1.00
R1885:Xrn2 UTSW 2 147049361 nonsense probably null
R2199:Xrn2 UTSW 2 147024750 missense probably damaging 0.96
R2884:Xrn2 UTSW 2 147047656 missense probably damaging 1.00
R3730:Xrn2 UTSW 2 147024809 missense probably benign 0.09
R3771:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3772:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3773:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3816:Xrn2 UTSW 2 147028200 missense probably damaging 1.00
R3927:Xrn2 UTSW 2 147038189 missense probably benign
R4173:Xrn2 UTSW 2 147047692 missense probably damaging 0.96
R4659:Xrn2 UTSW 2 147061474 missense probably benign 0.01
R4928:Xrn2 UTSW 2 147051718 missense possibly damaging 0.80
R5452:Xrn2 UTSW 2 147024713 critical splice acceptor site probably null
R5527:Xrn2 UTSW 2 147029755 missense probably benign 0.02
R6297:Xrn2 UTSW 2 147026570 missense probably damaging 1.00
R6301:Xrn2 UTSW 2 147063342 missense probably benign 0.05
R6705:Xrn2 UTSW 2 147036662 critical splice acceptor site probably null
R7173:Xrn2 UTSW 2 147042093 missense probably damaging 1.00
R7408:Xrn2 UTSW 2 147042097 critical splice donor site probably null
R7412:Xrn2 UTSW 2 147049346 missense probably damaging 0.99
R7501:Xrn2 UTSW 2 147029756 missense probably damaging 1.00
Z1177:Xrn2 UTSW 2 147028206 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACCACTGATATGAAGCAGACAG -3'
(R):5'- ACTTGCAGCTGGGAAAACC -3'

Sequencing Primer
(F):5'- ATGAGTGGAGTATATGCCA -3'
(R):5'- GAAAACCCCCATTAGTTGTTCCAGTG -3'
Posted On2018-04-02