Incidental Mutation 'R6316:Smpd1'
ID509987
Institutional Source Beutler Lab
Gene Symbol Smpd1
Ensembl Gene ENSMUSG00000037049
Gene Namesphingomyelin phosphodiesterase 1, acid lysosomal
SynonymsASM, aSMase, A-SMase, acid sphingomyelinase, Zn-SMase
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R6316 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105554360-105558389 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105555502 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 196 (V196A)
Ref Sequence ENSEMBL: ENSMUSP00000042187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046983] [ENSMUST00000081165] [ENSMUST00000186814] [ENSMUST00000187057] [ENSMUST00000188001] [ENSMUST00000188368] [ENSMUST00000189072] [ENSMUST00000189265] [ENSMUST00000189378] [ENSMUST00000190369] [ENSMUST00000191011] [ENSMUST00000191601]
Predicted Effect probably benign
Transcript: ENSMUST00000046983
AA Change: V196A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000042187
Gene: ENSMUSG00000037049
AA Change: V196A

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
SapB 85 163 1.05e-7 SMART
low complexity region 177 196 N/A INTRINSIC
Pfam:Metallophos 197 459 4.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081165
SMART Domains Protein: ENSMUSP00000079932
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 4.16e-38 SMART
PTB 538 667 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186814
Predicted Effect probably benign
Transcript: ENSMUST00000187057
SMART Domains Protein: ENSMUSP00000139899
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
WW 31 62 3.7e-7 SMART
low complexity region 64 76 N/A INTRINSIC
PTB 142 287 3.8e-41 SMART
PTB 313 442 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188001
Predicted Effect probably benign
Transcript: ENSMUST00000188368
SMART Domains Protein: ENSMUSP00000139788
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
WW 31 62 3.7e-7 SMART
low complexity region 64 76 N/A INTRINSIC
PTB 142 289 1.8e-40 SMART
PTB 315 444 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189072
SMART Domains Protein: ENSMUSP00000139575
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189265
SMART Domains Protein: ENSMUSP00000140137
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:PID 1 34 2.3e-6 PFAM
PTB 63 192 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189378
SMART Domains Protein: ENSMUSP00000140979
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190369
SMART Domains Protein: ENSMUSP00000140486
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191011
SMART Domains Protein: ENSMUSP00000140973
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191250
Predicted Effect probably benign
Transcript: ENSMUST00000191601
SMART Domains Protein: ENSMUSP00000140116
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 3.7e-7 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 1.8e-40 SMART
PTB 538 667 9.5e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211307
Predicted Effect probably benign
Transcript: ENSMUST00000211614
Meta Mutation Damage Score 0.0689 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lysosomal acid sphingomyelinase that converts sphingomyelin to ceramide. The encoded protein also has phospholipase C activity. Defects in this gene are a cause of Niemann-Pick disease type A (NPA) and Niemann-Pick disease type B (NPB). Multiple transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2010]
PHENOTYPE: Nullizygous mutations cause tremors, ataxia, altered lipid homeostasis, increased foam cell number, Purkinje cell loss and premature death, and may lead to hepatosplenomegaly, hunched posture, reduced weight, abnormal apoptosis, sperm defects, dyspnea, and high susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,313,959 T775A probably benign Het
Adam6a A T 12: 113,545,576 N523I probably benign Het
Adgrv1 T C 13: 81,499,068 T3118A possibly damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Asxl3 A G 18: 22,522,782 Y1283C probably damaging Het
BC005561 G C 5: 104,519,729 G706R probably damaging Het
Btbd2 T A 10: 80,644,778 I319F probably damaging Het
Eno4 G A 19: 58,960,291 probably null Het
Glis2 T A 16: 4,613,836 probably benign Het
Grin2b A T 6: 135,780,279 C395S probably benign Het
H1foo T C 6: 115,948,915 probably null Het
Kansl1l T A 1: 66,735,585 Y694F probably benign Het
Kcnj1 A T 9: 32,397,336 E332V probably damaging Het
Klhdc7a T C 4: 139,966,802 E278G probably benign Het
Krt33a T C 11: 100,014,201 N160D probably damaging Het
Ksr2 A G 5: 117,685,502 N448S probably damaging Het
Lpar6 A G 14: 73,239,334 Y245C probably damaging Het
Magel2 T C 7: 62,378,719 I457T possibly damaging Het
Manf A G 9: 106,889,186 L132P probably damaging Het
Moxd2 T C 6: 40,883,547 D321G probably damaging Het
Mtmr12 T A 15: 12,236,113 C153S probably null Het
Muc16 T C 9: 18,641,819 T4393A probably benign Het
Notch3 T C 17: 32,137,813 probably null Het
Olfr311 A G 11: 58,841,942 Y276C probably damaging Het
Pirb T A 7: 3,717,823 K225N probably damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Rilpl2 A G 5: 124,477,880 V69A probably damaging Het
Smdt1 T C 15: 82,348,009 V99A probably damaging Het
Supt20 TCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCAGCA 3: 54,727,648 probably benign Het
Tcte1 A G 17: 45,534,860 H130R probably benign Het
Tead1 C A 7: 112,891,839 Q296K probably damaging Het
Tmem163 C T 1: 127,551,365 S139N probably benign Het
Tor1aip2 G T 1: 156,062,094 D192Y probably damaging Het
Trgv2 G A 13: 19,336,742 Q61* probably null Het
Trib1 T C 15: 59,649,415 S85P probably benign Het
Trrap T A 5: 144,813,526 N1581K probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Xrn2 A G 2: 147,042,010 Y563C probably damaging Het
Other mutations in Smpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Smpd1 APN 7 105556641 missense probably damaging 0.99
IGL01147:Smpd1 APN 7 105555736 missense probably damaging 1.00
IGL01526:Smpd1 APN 7 105554775 missense probably benign 0.01
IGL01541:Smpd1 APN 7 105555826 missense possibly damaging 0.48
IGL01619:Smpd1 APN 7 105555342 missense possibly damaging 0.89
IGL01924:Smpd1 APN 7 105555448 missense probably benign 0.01
IGL03004:Smpd1 APN 7 105556674 missense possibly damaging 0.82
R0782:Smpd1 UTSW 7 105555343 missense possibly damaging 0.80
R1445:Smpd1 UTSW 7 105556674 missense possibly damaging 0.82
R1489:Smpd1 UTSW 7 105556554 unclassified probably null
R3683:Smpd1 UTSW 7 105555402 missense probably damaging 1.00
R3685:Smpd1 UTSW 7 105555402 missense probably damaging 1.00
R3977:Smpd1 UTSW 7 105555901 missense probably benign 0.29
R4850:Smpd1 UTSW 7 105555985 missense probably benign
R5084:Smpd1 UTSW 7 105556978 missense probably damaging 1.00
R6429:Smpd1 UTSW 7 105556928 missense probably damaging 1.00
R6672:Smpd1 UTSW 7 105555273 missense probably benign
R7156:Smpd1 UTSW 7 105554486 unclassified probably benign
R7883:Smpd1 UTSW 7 105556985 missense probably damaging 1.00
R7966:Smpd1 UTSW 7 105556985 missense probably damaging 1.00
X0021:Smpd1 UTSW 7 105557645 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACCACTAGATGTGTGCC -3'
(R):5'- TTTCTAGCGTTCGCAAGGGC -3'

Sequencing Primer
(F):5'- ACCACTAGATGTGTGCCAGTCAG -3'
(R):5'- GCAGGTCACACTTGCTGTAC -3'
Posted On2018-04-02