Incidental Mutation 'R6316:Kcnj1'
ID509990
Institutional Source Beutler Lab
Gene Symbol Kcnj1
Ensembl Gene ENSMUSG00000041248
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 1
SynonymsKir1.1, ROMK, ROMK-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6316 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location32372493-32399197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32397336 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 332 (E332V)
Ref Sequence ENSEMBL: ENSMUSP00000150540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047334] [ENSMUST00000172015] [ENSMUST00000213393]
Predicted Effect probably damaging
Transcript: ENSMUST00000047334
AA Change: E332V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046793
Gene: ENSMUSG00000041248
AA Change: E332V

DomainStartEndE-ValueType
Pfam:IRK 24 361 1.4e-155 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172015
AA Change: E352V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131625
Gene: ENSMUSG00000041248
AA Change: E352V

DomainStartEndE-ValueType
Pfam:IRK 44 373 7.6e-144 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213393
AA Change: E332V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.0804 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. It is activated by internal ATP and probably plays an important role in potassium homeostasis. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Mutations in this gene have been associated with antenatal Bartter syndrome, which is characterized by salt wasting, hypokalemic alkalosis, hypercalciuria, and low blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygotes for a null mutation die before weaning with impaired electrolyte, acid-base, and fluid-volume homeostasis, reduced NaCl absorption in the thick ascending limb, and abnormal tubuloglomerular feedback. A colony of mutants with extended suvival serves as a model for Bartter's syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,313,959 T775A probably benign Het
Adam6a A T 12: 113,545,576 N523I probably benign Het
Adgrv1 T C 13: 81,499,068 T3118A possibly damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Asxl3 A G 18: 22,522,782 Y1283C probably damaging Het
BC005561 G C 5: 104,519,729 G706R probably damaging Het
Btbd2 T A 10: 80,644,778 I319F probably damaging Het
Eno4 G A 19: 58,960,291 probably null Het
Glis2 T A 16: 4,613,836 probably benign Het
Grin2b A T 6: 135,780,279 C395S probably benign Het
H1foo T C 6: 115,948,915 probably null Het
Kansl1l T A 1: 66,735,585 Y694F probably benign Het
Klhdc7a T C 4: 139,966,802 E278G probably benign Het
Krt33a T C 11: 100,014,201 N160D probably damaging Het
Ksr2 A G 5: 117,685,502 N448S probably damaging Het
Lpar6 A G 14: 73,239,334 Y245C probably damaging Het
Magel2 T C 7: 62,378,719 I457T possibly damaging Het
Manf A G 9: 106,889,186 L132P probably damaging Het
Moxd2 T C 6: 40,883,547 D321G probably damaging Het
Mtmr12 T A 15: 12,236,113 C153S probably null Het
Muc16 T C 9: 18,641,819 T4393A probably benign Het
Notch3 T C 17: 32,137,813 probably null Het
Olfr311 A G 11: 58,841,942 Y276C probably damaging Het
Pirb T A 7: 3,717,823 K225N probably damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Rilpl2 A G 5: 124,477,880 V69A probably damaging Het
Smdt1 T C 15: 82,348,009 V99A probably damaging Het
Smpd1 T C 7: 105,555,502 V196A probably benign Het
Supt20 TCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCAGCA 3: 54,727,648 probably benign Het
Tcte1 A G 17: 45,534,860 H130R probably benign Het
Tead1 C A 7: 112,891,839 Q296K probably damaging Het
Tmem163 C T 1: 127,551,365 S139N probably benign Het
Tor1aip2 G T 1: 156,062,094 D192Y probably damaging Het
Trgv2 G A 13: 19,336,742 Q61* probably null Het
Trib1 T C 15: 59,649,415 S85P probably benign Het
Trrap T A 5: 144,813,526 N1581K probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Xrn2 A G 2: 147,042,010 Y563C probably damaging Het
Other mutations in Kcnj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Kcnj1 APN 9 32396498 missense probably benign 0.01
IGL02958:Kcnj1 APN 9 32396555 missense probably damaging 1.00
IGL03285:Kcnj1 APN 9 32396861 missense possibly damaging 0.67
R1179:Kcnj1 UTSW 9 32396766 missense probably damaging 0.96
R1503:Kcnj1 UTSW 9 32396492 missense probably damaging 0.98
R1918:Kcnj1 UTSW 9 32396738 missense probably benign 0.00
R4439:Kcnj1 UTSW 9 32394118 intron probably benign
R4659:Kcnj1 UTSW 9 32394148 missense probably benign
R4661:Kcnj1 UTSW 9 32396622 missense probably benign 0.14
R4917:Kcnj1 UTSW 9 32396760 missense probably damaging 0.99
R4918:Kcnj1 UTSW 9 32396760 missense probably damaging 0.99
R5385:Kcnj1 UTSW 9 32396723 missense probably damaging 1.00
R6017:Kcnj1 UTSW 9 32394104 intron probably benign
R6036:Kcnj1 UTSW 9 32397125 missense probably benign 0.15
R6036:Kcnj1 UTSW 9 32397125 missense probably benign 0.15
R6117:Kcnj1 UTSW 9 32397182 missense probably damaging 1.00
R6245:Kcnj1 UTSW 9 32396867 missense probably damaging 1.00
R6585:Kcnj1 UTSW 9 32397261 missense probably benign
R6988:Kcnj1 UTSW 9 32396585 missense probably benign 0.17
R7116:Kcnj1 UTSW 9 32396981 missense possibly damaging 0.91
R7393:Kcnj1 UTSW 9 32397018 missense probably damaging 1.00
R7870:Kcnj1 UTSW 9 32396585 missense probably benign 0.17
R7953:Kcnj1 UTSW 9 32396585 missense probably benign 0.17
R8072:Kcnj1 UTSW 9 32397297 missense probably damaging 1.00
Z1177:Kcnj1 UTSW 9 32397359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGCGGCAGAAACTCTTTC -3'
(R):5'- TGCTTCTGAACACAGCCAG -3'

Sequencing Primer
(F):5'- TCCCAACAGGACTTCGAGTTG -3'
(R):5'- AGCACTTAGGTCCTTGAGAGACTC -3'
Posted On2018-04-02