Incidental Mutation 'R6316:Krt33a'
ID509994
Institutional Source Beutler Lab
Gene Symbol Krt33a
Ensembl Gene ENSMUSG00000035592
Gene Namekeratin 33A
Synonyms2310015J09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6316 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location100011195-100016212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100014201 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 160 (N160D)
Ref Sequence ENSEMBL: ENSMUSP00000018399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018399]
Predicted Effect probably damaging
Transcript: ENSMUST00000018399
AA Change: N160D

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018399
Gene: ENSMUSG00000035592
AA Change: N160D

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Filament 55 366 1.99e-148 SMART
internal_repeat_1 368 385 6.11e-5 PROSPERO
internal_repeat_1 384 399 6.11e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138756
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype PHENOTYPE: Mutations of this gene cause the hair coat to appear either shiny, reflective and "polished" or greasy looking, disheveled and "spikey." [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,313,959 T775A probably benign Het
Adam6a A T 12: 113,545,576 N523I probably benign Het
Adgrv1 T C 13: 81,499,068 T3118A possibly damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Asxl3 A G 18: 22,522,782 Y1283C probably damaging Het
BC005561 G C 5: 104,519,729 G706R probably damaging Het
Btbd2 T A 10: 80,644,778 I319F probably damaging Het
Eno4 G A 19: 58,960,291 probably null Het
Glis2 T A 16: 4,613,836 probably benign Het
Grin2b A T 6: 135,780,279 C395S probably benign Het
H1foo T C 6: 115,948,915 probably null Het
Kansl1l T A 1: 66,735,585 Y694F probably benign Het
Kcnj1 A T 9: 32,397,336 E332V probably damaging Het
Klhdc7a T C 4: 139,966,802 E278G probably benign Het
Ksr2 A G 5: 117,685,502 N448S probably damaging Het
Lpar6 A G 14: 73,239,334 Y245C probably damaging Het
Magel2 T C 7: 62,378,719 I457T possibly damaging Het
Manf A G 9: 106,889,186 L132P probably damaging Het
Moxd2 T C 6: 40,883,547 D321G probably damaging Het
Mtmr12 T A 15: 12,236,113 C153S probably null Het
Muc16 T C 9: 18,641,819 T4393A probably benign Het
Notch3 T C 17: 32,137,813 probably null Het
Olfr311 A G 11: 58,841,942 Y276C probably damaging Het
Pirb T A 7: 3,717,823 K225N probably damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Rilpl2 A G 5: 124,477,880 V69A probably damaging Het
Smdt1 T C 15: 82,348,009 V99A probably damaging Het
Smpd1 T C 7: 105,555,502 V196A probably benign Het
Supt20 TCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCAGCA 3: 54,727,648 probably benign Het
Tcte1 A G 17: 45,534,860 H130R probably benign Het
Tead1 C A 7: 112,891,839 Q296K probably damaging Het
Tmem163 C T 1: 127,551,365 S139N probably benign Het
Tor1aip2 G T 1: 156,062,094 D192Y probably damaging Het
Trgv2 G A 13: 19,336,742 Q61* probably null Het
Trib1 T C 15: 59,649,415 S85P probably benign Het
Trrap T A 5: 144,813,526 N1581K probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Xrn2 A G 2: 147,042,010 Y563C probably damaging Het
Other mutations in Krt33a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Krt33a APN 11 100012017 missense probably benign 0.35
IGL02412:Krt33a APN 11 100011979 missense probably benign 0.01
IGL02523:Krt33a APN 11 100011692 missense probably benign 0.02
Polished UTSW 11 100012611 missense probably damaging 1.00
Polished2 UTSW 11 100015850 missense probably benign 0.10
Spikey UTSW 11 100011939 missense probably damaging 1.00
R0492:Krt33a UTSW 11 100016083 missense probably benign 0.02
R0496:Krt33a UTSW 11 100012329 splice site probably benign
R0691:Krt33a UTSW 11 100012715 missense probably damaging 1.00
R1077:Krt33a UTSW 11 100015937 missense probably benign
R1624:Krt33a UTSW 11 100014246 missense probably damaging 1.00
R1911:Krt33a UTSW 11 100012349 missense probably benign 0.35
R1944:Krt33a UTSW 11 100012709 missense probably benign 0.10
R1945:Krt33a UTSW 11 100012709 missense probably benign 0.10
R2254:Krt33a UTSW 11 100014178 missense possibly damaging 0.95
R2255:Krt33a UTSW 11 100014178 missense possibly damaging 0.95
R3716:Krt33a UTSW 11 100014165 missense probably benign 0.01
R4377:Krt33a UTSW 11 100012427 missense possibly damaging 0.46
R5233:Krt33a UTSW 11 100014135 missense probably damaging 1.00
R6029:Krt33a UTSW 11 100012463 missense probably benign 0.01
R6807:Krt33a UTSW 11 100012383 missense possibly damaging 0.61
R7272:Krt33a UTSW 11 100012011 missense probably damaging 1.00
R7323:Krt33a UTSW 11 100011975 missense probably benign 0.08
R7461:Krt33a UTSW 11 100011939 missense probably damaging 1.00
R7613:Krt33a UTSW 11 100011939 missense probably damaging 1.00
R7657:Krt33a UTSW 11 100015867 missense probably benign
R7748:Krt33a UTSW 11 100011602 missense probably benign
Z1176:Krt33a UTSW 11 100011914 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTGAGCCTCAACTCACAGCC -3'
(R):5'- ACCTACTTCTGGATCTTGACAAC -3'

Sequencing Primer
(F):5'- TCTCCCCACAGCCCGTG -3'
(R):5'- TGGATCTTGACAACTTAAATAGAAGG -3'
Posted On2018-04-02