Incidental Mutation 'R6316:Smdt1'
ID510001
Institutional Source Beutler Lab
Gene Symbol Smdt1
Ensembl Gene ENSMUSG00000022452
Gene Namesingle-pass membrane protein with aspartate rich tail 1
SynonymsEmre, 1500032L24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6316 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location82338959-82349091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82348009 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 99 (V99A)
Ref Sequence ENSEMBL: ENSMUSP00000155835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023085] [ENSMUST00000023086] [ENSMUST00000050349] [ENSMUST00000159054] [ENSMUST00000160994] [ENSMUST00000161178] [ENSMUST00000161892] [ENSMUST00000229537] [ENSMUST00000230360] [ENSMUST00000230494] [ENSMUST00000230676]
Predicted Effect probably benign
Transcript: ENSMUST00000023085
SMART Domains Protein: ENSMUSP00000023085
Gene: ENSMUSG00000022450

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Complex1_LYR 33 95 8.1e-13 PFAM
Pfam:Complex1_LYR_1 33 97 4.2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000023086
AA Change: V99A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023086
Gene: ENSMUSG00000022452
AA Change: V99A

DomainStartEndE-ValueType
Pfam:DDDD 33 107 1.7e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050349
SMART Domains Protein: ENSMUSP00000060598
Gene: ENSMUSG00000049687

DomainStartEndE-ValueType
PH 18 123 1.02e-10 SMART
coiled coil region 128 150 N/A INTRINSIC
Blast:PH 192 242 1e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159054
AA Change: V63A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125429
Gene: ENSMUSG00000022452
AA Change: V63A

DomainStartEndE-ValueType
Pfam:DDDD 8 70 1.9e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159942
Predicted Effect probably damaging
Transcript: ENSMUST00000160994
AA Change: V37A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000161178
SMART Domains Protein: ENSMUSP00000124703
Gene: ENSMUSG00000049687

DomainStartEndE-ValueType
PH 18 123 1.02e-10 SMART
coiled coil region 128 150 N/A INTRINSIC
Blast:PH 192 242 1e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229427
Predicted Effect probably benign
Transcript: ENSMUST00000229537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230165
Predicted Effect probably damaging
Transcript: ENSMUST00000230360
AA Change: V99A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230589
Predicted Effect probably benign
Transcript: ENSMUST00000230676
Meta Mutation Damage Score 0.6907 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,313,959 T775A probably benign Het
Adam6a A T 12: 113,545,576 N523I probably benign Het
Adgrv1 T C 13: 81,499,068 T3118A possibly damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Asxl3 A G 18: 22,522,782 Y1283C probably damaging Het
BC005561 G C 5: 104,519,729 G706R probably damaging Het
Btbd2 T A 10: 80,644,778 I319F probably damaging Het
Eno4 G A 19: 58,960,291 probably null Het
Glis2 T A 16: 4,613,836 probably benign Het
Grin2b A T 6: 135,780,279 C395S probably benign Het
H1foo T C 6: 115,948,915 probably null Het
Kansl1l T A 1: 66,735,585 Y694F probably benign Het
Kcnj1 A T 9: 32,397,336 E332V probably damaging Het
Klhdc7a T C 4: 139,966,802 E278G probably benign Het
Krt33a T C 11: 100,014,201 N160D probably damaging Het
Ksr2 A G 5: 117,685,502 N448S probably damaging Het
Lpar6 A G 14: 73,239,334 Y245C probably damaging Het
Magel2 T C 7: 62,378,719 I457T possibly damaging Het
Manf A G 9: 106,889,186 L132P probably damaging Het
Moxd2 T C 6: 40,883,547 D321G probably damaging Het
Mtmr12 T A 15: 12,236,113 C153S probably null Het
Muc16 T C 9: 18,641,819 T4393A probably benign Het
Notch3 T C 17: 32,137,813 probably null Het
Olfr311 A G 11: 58,841,942 Y276C probably damaging Het
Pirb T A 7: 3,717,823 K225N probably damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Rilpl2 A G 5: 124,477,880 V69A probably damaging Het
Smpd1 T C 7: 105,555,502 V196A probably benign Het
Supt20 TCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCAGCA 3: 54,727,648 probably benign Het
Tcte1 A G 17: 45,534,860 H130R probably benign Het
Tead1 C A 7: 112,891,839 Q296K probably damaging Het
Tmem163 C T 1: 127,551,365 S139N probably benign Het
Tor1aip2 G T 1: 156,062,094 D192Y probably damaging Het
Trgv2 G A 13: 19,336,742 Q61* probably null Het
Trib1 T C 15: 59,649,415 S85P probably benign Het
Trrap T A 5: 144,813,526 N1581K probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Xrn2 A G 2: 147,042,010 Y563C probably damaging Het
Other mutations in Smdt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Smdt1 APN 15 82346183 missense possibly damaging 0.46
IGL01505:Smdt1 APN 15 82347893 unclassified probably benign
R1485:Smdt1 UTSW 15 82346232 missense probably benign 0.10
R1542:Smdt1 UTSW 15 82346175 missense possibly damaging 0.46
R5503:Smdt1 UTSW 15 82347900 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CAGTAGTCCATTGGAGGCTTGG -3'
(R):5'- AGTTGACTGAAGTCCATCAAGG -3'

Sequencing Primer
(F):5'- TGGAGGCTTGGGCGCAG -3'
(R):5'- CACTGAGGACCTTAACCTAGTGG -3'
Posted On2018-04-02