Incidental Mutation 'R6317:Slc9a9'
ID510041
Institutional Source Beutler Lab
Gene Symbol Slc9a9
Ensembl Gene ENSMUSG00000031129
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 9
Synonyms5730527A11Rik, Nhe9
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6317 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location94669909-95230445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94939459 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 300 (T300A)
Ref Sequence ENSEMBL: ENSMUSP00000033463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033463]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033463
AA Change: T300A

PolyPhen 2 Score 0.515 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000033463
Gene: ENSMUSG00000031129
AA Change: T300A

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 28 486 2.6e-89 PFAM
low complexity region 594 600 N/A INTRINSIC
low complexity region 621 635 N/A INTRINSIC
Meta Mutation Damage Score 0.2358 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium/proton exchanger that is a member of the solute carrier 9 protein family. The encoded protein localizes the to the late recycling endosomes and may play an important role in maintaining cation homeostasis. Mutations in this gene are associated with autism susceptibility 16 and attention-deficit/hyperactivity disorder. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,468,193 N206S probably damaging Het
Abcf2 A T 5: 24,569,158 Y315* probably null Het
Adck1 T G 12: 88,402,151 V133G probably damaging Het
Aoc2 T C 11: 101,325,466 F125S probably damaging Het
As3mt A G 19: 46,724,971 D319G probably benign Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz1a T C 12: 54,954,800 Q145R possibly damaging Het
BC067074 T A 13: 113,368,268 L1977H probably benign Het
Bhlhe22 A G 3: 18,055,614 E276G probably damaging Het
Cdo1 C A 18: 46,728,037 V36L probably benign Het
Ces1h A G 8: 93,357,418 F388S unknown Het
Col6a5 T A 9: 105,889,067 N1885Y probably damaging Het
Corin A T 5: 72,339,045 C522S probably damaging Het
Csmd1 G T 8: 16,710,642 T159K possibly damaging Het
Cwc27 T A 13: 104,804,261 K197* probably null Het
Cyp20a1 T C 1: 60,352,124 S26P probably damaging Het
Daxx T A 17: 33,911,975 D321E probably damaging Het
Gria2 A C 3: 80,741,004 Y142D possibly damaging Het
Gspt1 T C 16: 11,223,208 probably null Het
Ighv1-80 A T 12: 115,912,645 V17D probably damaging Het
Ints4 T A 7: 97,529,218 L675* probably null Het
Kif13a C T 13: 46,826,757 R173Q probably damaging Het
Map3k2 T C 18: 32,203,033 I91T probably damaging Het
Map3k8 A G 18: 4,348,979 probably null Het
Mcemp1 G A 8: 3,667,284 W101* probably null Het
Mgea5 A T 19: 45,771,680 probably null Het
Naca T C 10: 128,044,124 I1675T probably benign Het
Nol9 T C 4: 152,041,057 F155S probably damaging Het
Obscn C A 11: 59,069,895 D3406Y probably damaging Het
Obsl1 A G 1: 75,489,629 V1485A possibly damaging Het
Olfr151 T C 9: 37,730,429 K185E possibly damaging Het
Otog C A 7: 46,301,215 P337H probably damaging Het
Patl1 T C 19: 11,920,878 L140P probably damaging Het
Pcca G A 14: 122,582,623 V60M probably damaging Het
Pex11g G T 8: 3,464,092 D23E probably damaging Het
Phactr2 A T 10: 13,261,882 M172K probably damaging Het
Plce1 G A 19: 38,524,530 W91* probably null Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Podn A G 4: 108,027,160 F44S probably damaging Het
Polr3e A G 7: 120,927,982 D87G possibly damaging Het
Prmt2 T A 10: 76,222,517 I153F probably benign Het
Prpf6 T C 2: 181,631,436 V258A probably benign Het
Ptpn21 G T 12: 98,689,262 A482E probably damaging Het
Qrich1 A T 9: 108,534,292 N339Y probably damaging Het
Rabgap1 T A 2: 37,542,647 V750D possibly damaging Het
Reg3d G A 6: 78,377,445 P58S probably damaging Het
Rp1 A G 1: 4,041,989 L1213P unknown Het
Sema6b A G 17: 56,124,047 L872S probably benign Het
Serpinb7 T C 1: 107,451,706 I281T probably damaging Het
Shank2 T C 7: 144,285,084 V685A possibly damaging Het
Slc28a2 A G 2: 122,454,499 I323V possibly damaging Het
Slc7a6 A T 8: 106,192,467 I228F probably damaging Het
Spta1 A G 1: 174,241,087 N2151S probably damaging Het
Sult2a1 T A 7: 13,836,020 I96L probably benign Het
Tgm2 T C 2: 158,124,150 D528G probably benign Het
Ubl7 T C 9: 57,911,173 probably null Het
Vcan T A 13: 89,691,597 I983L probably benign Het
Vmn1r172 T C 7: 23,660,317 L209P probably damaging Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn1r3 T C 4: 3,184,993 S105G probably benign Het
Zfp644 A T 5: 106,635,845 H945Q probably damaging Het
Other mutations in Slc9a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Slc9a9 APN 9 95055459 missense probably benign 0.03
IGL01394:Slc9a9 APN 9 95123037 missense probably benign
IGL01434:Slc9a9 APN 9 95019194 missense possibly damaging 0.49
IGL01715:Slc9a9 APN 9 94960446 missense probably damaging 1.00
IGL01821:Slc9a9 APN 9 95228950 missense probably benign
IGL02963:Slc9a9 APN 9 95020714 critical splice donor site probably null
IGL03211:Slc9a9 APN 9 95137990 splice site probably benign
ANU18:Slc9a9 UTSW 9 95055459 missense probably benign 0.03
R0306:Slc9a9 UTSW 9 95137934 missense probably benign
R0382:Slc9a9 UTSW 9 94685217 missense probably benign 0.18
R0388:Slc9a9 UTSW 9 94939563 critical splice donor site probably null
R1509:Slc9a9 UTSW 9 95228958 missense probably benign
R1785:Slc9a9 UTSW 9 95019193 missense possibly damaging 0.95
R4018:Slc9a9 UTSW 9 94685163 missense probably benign 0.03
R4167:Slc9a9 UTSW 9 95228899 missense probably damaging 0.98
R4170:Slc9a9 UTSW 9 95228899 missense probably damaging 0.98
R4695:Slc9a9 UTSW 9 94936449 critical splice donor site probably benign
R5400:Slc9a9 UTSW 9 94712901 missense probably damaging 1.00
R5609:Slc9a9 UTSW 9 94809937 missense probably damaging 1.00
R5684:Slc9a9 UTSW 9 95055508 missense possibly damaging 0.89
R6015:Slc9a9 UTSW 9 94939549 missense probably benign 0.29
R6102:Slc9a9 UTSW 9 94936429 missense probably benign 0.03
R6398:Slc9a9 UTSW 9 94670227 missense probably benign 0.00
R6476:Slc9a9 UTSW 9 94685138 missense probably benign 0.00
R6501:Slc9a9 UTSW 9 94936371 missense probably benign 0.01
R6603:Slc9a9 UTSW 9 94939546 missense probably damaging 0.98
R6611:Slc9a9 UTSW 9 94939478 missense probably benign 0.18
R6700:Slc9a9 UTSW 9 94936311 missense possibly damaging 0.66
R6824:Slc9a9 UTSW 9 95227198 missense probably damaging 1.00
R6931:Slc9a9 UTSW 9 94670086 missense possibly damaging 0.73
R6975:Slc9a9 UTSW 9 94960446 missense probably damaging 1.00
R6987:Slc9a9 UTSW 9 94669990 start gained probably benign
R7325:Slc9a9 UTSW 9 94712898 missense probably benign 0.24
R7374:Slc9a9 UTSW 9 95055489 missense possibly damaging 0.90
R7437:Slc9a9 UTSW 9 95228941 missense probably benign 0.00
R7614:Slc9a9 UTSW 9 94855739 missense probably damaging 1.00
R8412:Slc9a9 UTSW 9 95229039 missense probably damaging 1.00
R8501:Slc9a9 UTSW 9 94855739 missense probably damaging 1.00
R8514:Slc9a9 UTSW 9 94936365 missense probably benign 0.01
X0010:Slc9a9 UTSW 9 94685208 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ATGGACGTCACGCTAACTCC -3'
(R):5'- GCAGAGGCTGATTTTGATAGAATCC -3'

Sequencing Primer
(F):5'- GACGTCACGCTAACTCCTTGAG -3'
(R):5'- CACTATTTAAGAGAGACTTCATTCCC -3'
Posted On2018-04-02