Mutagenetix > Incidental Mutation

Incidental Mutation 'R6320:Strc'

510075

Institutional Source

Beutler Lab

Gene Symbol

Strc

Ensembl Gene

ENSMUSG00000033498

Gene Name

stereocilin

Synonyms

DFNB16

MMRRC Submission

044475-MU

Accession Numbers

Genbank: NM_080459; MGI: 2153816

Essential gene?

Probably non essential (E-score: 0.222) question?

Stock #

R6320 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121363728-121387168 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 121374958 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 25 (D25V)

Ref Sequence

ENSEMBL: ENSMUSP00000118211 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]

AlphaFold

Q8VIM6

Predicted Effect

probably benign
Transcript: ENSMUST00000038389
AA Change: D897V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: D897V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	74	87	N/A	INTRINSIC
low complexity region	108	119	N/A	INTRINSIC
low complexity region	132	161	N/A	INTRINSIC
low complexity region	277	291	N/A	INTRINSIC
low complexity region	376	425	N/A	INTRINSIC
low complexity region	610	635	N/A	INTRINSIC
low complexity region	656	677	N/A	INTRINSIC
low complexity region	728	746	N/A	INTRINSIC
low complexity region	898	921	N/A	INTRINSIC
low complexity region	1168	1194	N/A	INTRINSIC
low complexity region	1287	1302	N/A	INTRINSIC
low complexity region	1560	1580	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129136
AA Change: D25V

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498
AA Change: D25V

Domain	Start	End	E-Value	Type
low complexity region	26	49	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134443

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149219

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150332

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	C	7: 118,753,849	V189A	probably benign	Het
Agtr1b	G	T	3: 20,315,779	A221D	probably benign	Het
Aldh18a1	A	T	19: 40,570,561	D280E	probably benign	Het
Apob	G	A	12: 7,989,194	D475N	probably benign	Het
Bmi1	C	T	2: 18,684,375	T290I	probably benign	Het
Brd8	A	T	18: 34,613,239	D139E	possibly damaging	Het
Cacna1e	C	A	1: 154,441,524	V1467F	possibly damaging	Het
Cdh15	A	G	8: 122,864,347	D445G	probably benign	Het
Ceacam5	T	A	7: 17,747,198	L290H	probably damaging	Het
Celsr1	G	T	15: 85,900,959	Q3025K	probably benign	Het
Chil1	T	A	1: 134,182,258	M1K	probably null	Het
Crybg2	T	C	4: 134,081,426	S1404P	probably damaging	Het
Cubn	C	A	2: 13,280,195	C3470F	probably damaging	Het
Cyp20a1	T	C	1: 60,352,172		probably null	Het
Cyp24a1	G	T	2: 170,486,784	T408K	probably benign	Het
Cyp2a12	A	T	7: 27,031,152	I181F	possibly damaging	Het
Dnm1l	A	T	16: 16,332,088	I268N	probably damaging	Het
Eif2a	A	G	3: 58,557,096		probably null	Het
Epg5	T	C	18: 77,962,398	F701S	probably damaging	Het
Fbxo46	T	C	7: 19,136,541	S362P	possibly damaging	Het
Fgf22	A	G	10: 79,756,996		probably benign	Het
Fhod1	A	C	8: 105,337,350		probably benign	Het
Flnc	T	A	6: 29,459,063	V2448D	probably damaging	Het
Gm2696	G	T	10: 77,836,138		probably benign	Het
Gmpr	T	C	13: 45,532,398	S214P	possibly damaging	Het
Krt6a	A	G	15: 101,692,309	V308A	probably damaging	Het
Lig3	T	A	11: 82,794,007		probably null	Het
Lrrc37a	T	A	11: 103,504,051	N183Y	probably benign	Het
Mapk8ip3	C	A	17: 24,906,905	G422V	probably damaging	Het
Mks1	T	C	11: 87,855,499	S97P	probably benign	Het
Mphosph9	A	T	5: 124,324,961	V7E	probably damaging	Het
Msh5	A	G	17: 35,029,924	L711P	probably damaging	Het
Naga	T	A	15: 82,332,203		probably null	Het
Nlrp10	T	A	7: 108,925,746	T176S	possibly damaging	Het
Nqo1	T	C	8: 107,388,950	N232D	probably benign	Het
Olfr11	T	A	13: 21,639,248	I92L	probably damaging	Het
Olfr50	C	G	2: 36,793,573	N112K	possibly damaging	Het
P2ry6	A	G	7: 100,938,396	F252S	probably damaging	Het
P3h3	G	A	6: 124,854,872	R317W	probably benign	Het
Palm2	T	A	4: 57,710,173	C373S	probably damaging	Het
Pdzd3	A	G	9: 44,248,683	V380A	probably benign	Het
Phkb	T	A	8: 85,875,698	D39E	probably benign	Het
Psg16	G	A	7: 17,088,187	G23D	probably damaging	Het
Ptgr2	T	A	12: 84,302,337	I150K	probably benign	Het
Ptprf	A	G	4: 118,212,814	V1457A	probably benign	Het
Sart3	A	T	5: 113,751,240	Y508N	probably benign	Het
Sh3bp1	C	T	15: 78,911,515	P615S	probably damaging	Het
Ska3	A	T	14: 57,816,691	N267K	probably benign	Het
Slc26a7	A	G	4: 14,524,498	I462T	probably benign	Het
Slu7	C	T	11: 43,441,489	A244V	probably benign	Het
Smarca4	C	T	9: 21,637,375	P319L	probably damaging	Het
Smg9	A	G	7: 24,420,861	D420G	probably benign	Het
Syne2	T	G	12: 76,061,650	V936G	probably damaging	Het
Tbc1d7	C	T	13: 43,152,933		probably benign	Het
Terb1	C	A	8: 104,447,199	D751Y	probably damaging	Het
Trpc1	A	G	9: 95,721,250	Y410H	probably damaging	Het
Ush2a	A	G	1: 188,356,846	N333D	probably benign	Het
Usp34	T	C	11: 23,452,520	S2438P	probably damaging	Het
Zbtb17	G	A	4: 141,463,383	G171S	probably benign	Het
Zfp7	G	A	15: 76,890,610	G284D	possibly damaging	Het
Zfyve26	A	G	12: 79,240,002	S2271P	probably damaging	Het
Zscan18	G	A	7: 12,775,220		probably benign	Het

Other mutations in Strc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Strc	APN	2	121365060	missense	probably benign	0.39
IGL01152:Strc	APN	2	121370795	missense	probably benign
IGL01608:Strc	APN	2	121375594	missense	probably benign	0.05
IGL01695:Strc	APN	2	121375298	missense	probably damaging	1.00
IGL01715:Strc	APN	2	121365737	splice site	probably null
IGL01906:Strc	APN	2	121377634	missense	probably benign
IGL02135:Strc	APN	2	121364834	missense	probably damaging	1.00
IGL02416:Strc	APN	2	121369058	missense	probably damaging	1.00
IGL02455:Strc	APN	2	121375791	unclassified	probably benign
IGL03029:Strc	APN	2	121364044	missense	possibly damaging	0.95
IGL03176:Strc	APN	2	121372180	missense	probably damaging	0.99
IGL03272:Strc	APN	2	121371751	missense	probably damaging	1.00
3-1:Strc	UTSW	2	121373680	missense	probably damaging	0.99
IGL02799:Strc	UTSW	2	121379236	missense	probably damaging	1.00
PIT4283001:Strc	UTSW	2	121375307	missense	probably damaging	1.00
R0022:Strc	UTSW	2	121368393	missense	probably damaging	1.00
R0494:Strc	UTSW	2	121379533	missense	probably damaging	0.99
R1065:Strc	UTSW	2	121366651	missense	probably damaging	1.00
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1203:Strc	UTSW	2	121372123	missense	possibly damaging	0.66
R1343:Strc	UTSW	2	121365115	missense	probably benign	0.21
R1544:Strc	UTSW	2	121372738	splice site	probably null
R1650:Strc	UTSW	2	121380885	start gained	probably benign
R1840:Strc	UTSW	2	121379296	missense	probably damaging	1.00
R1983:Strc	UTSW	2	121371037	missense	possibly damaging	0.54
R2035:Strc	UTSW	2	121374934	missense	probably damaging	1.00
R2058:Strc	UTSW	2	121378887	missense	probably damaging	1.00
R2158:Strc	UTSW	2	121365862	missense	probably benign	0.10
R2219:Strc	UTSW	2	121364523	missense	probably damaging	1.00
R2680:Strc	UTSW	2	121365111	missense	probably damaging	0.99
R4375:Strc	UTSW	2	121380823	missense	unknown
R4563:Strc	UTSW	2	121365805	missense	probably benign	0.02
R4578:Strc	UTSW	2	121378003	missense	possibly damaging	0.94
R4607:Strc	UTSW	2	121372945	missense	probably benign	0.31
R4651:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4652:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4790:Strc	UTSW	2	121375594	missense	probably benign	0.05
R5480:Strc	UTSW	2	121364819	missense	probably benign	0.00
R5580:Strc	UTSW	2	121375012	missense	probably damaging	0.99
R5679:Strc	UTSW	2	121368100	missense	probably benign	0.03
R5703:Strc	UTSW	2	121370814	missense	probably benign
R5841:Strc	UTSW	2	121365877	missense	probably benign	0.29
R5917:Strc	UTSW	2	121379309	missense	probably benign
R5958:Strc	UTSW	2	121376922	missense	possibly damaging	0.56
R6619:Strc	UTSW	2	121368432	missense	probably damaging	0.99
R6695:Strc	UTSW	2	121377224	missense	probably benign	0.35
R6970:Strc	UTSW	2	121378014	missense	probably benign	0.41
R7018:Strc	UTSW	2	121369058	missense	probably damaging	1.00
R7045:Strc	UTSW	2	121370726	missense	probably damaging	1.00
R7190:Strc	UTSW	2	121369026	missense	probably benign	0.14
R7283:Strc	UTSW	2	121379452	missense	probably damaging	0.99
R7694:Strc	UTSW	2	121377096	missense	probably damaging	1.00
R7699:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7700:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7756:Strc	UTSW	2	121370946	missense	probably benign
R7758:Strc	UTSW	2	121370946	missense	probably benign
R7822:Strc	UTSW	2	121377738	missense	probably benign	0.01
R7830:Strc	UTSW	2	121375049	missense	probably damaging	0.99
R7953:Strc	UTSW	2	121377363	missense	probably damaging	0.99
R8137:Strc	UTSW	2	121366738	missense	probably damaging	0.98
R8394:Strc	UTSW	2	121379009	missense	probably benign	0.00
R8427:Strc	UTSW	2	121377531	missense	probably damaging	1.00
R8792:Strc	UTSW	2	121377805	missense	probably damaging	0.99
R8874:Strc	UTSW	2	121374872	critical splice donor site	probably null
R8947:Strc	UTSW	2	121370989	missense	probably benign	0.09
R9285:Strc	UTSW	2	121364798	missense	probably damaging	1.00
R9302:Strc	UTSW	2	121380855	missense	unknown
R9386:Strc	UTSW	2	121367730	missense	probably damaging	0.99
R9438:Strc	UTSW	2	121368166	missense	probably damaging	1.00
R9581:Strc	UTSW	2	121377447	missense	probably damaging	0.99
Z1176:Strc	UTSW	2	121375521	missense	probably damaging	0.98
Z1176:Strc	UTSW	2	121379044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCTGCTACTGGCCAGCTATC -3'
(R):5'- TACAGAGAGGTCCCTTTCAGG -3'

Sequencing Primer
(F):5'- CAGGGCCTGGATCTGAGATG -3'
(R):5'- GAGACTCTCCTTCCTGTCCACAG -3'

Posted On

2018-04-02