Incidental Mutation 'R6320:Strc'
ID510075
Institutional Source Beutler Lab
Gene Symbol Strc
Ensembl Gene ENSMUSG00000033498
Gene Namestereocilin
SynonymsDFNB16
MMRRC Submission
Accession Numbers

Genbank: NM_080459; MGI: 2153816

Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R6320 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location121363728-121387168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121374958 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 25 (D25V)
Ref Sequence ENSEMBL: ENSMUSP00000118211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]
Predicted Effect probably benign
Transcript: ENSMUST00000038389
AA Change: D897V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: D897V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129136
AA Change: D25V

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498
AA Change: D25V

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150332
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,753,849 V189A probably benign Het
Agtr1b G T 3: 20,315,779 A221D probably benign Het
Aldh18a1 A T 19: 40,570,561 D280E probably benign Het
Apob G A 12: 7,989,194 D475N probably benign Het
Bmi1 C T 2: 18,684,375 T290I probably benign Het
Brd8 A T 18: 34,613,239 D139E possibly damaging Het
Cacna1e C A 1: 154,441,524 V1467F possibly damaging Het
Cdh15 A G 8: 122,864,347 D445G probably benign Het
Ceacam5 T A 7: 17,747,198 L290H probably damaging Het
Celsr1 G T 15: 85,900,959 Q3025K probably benign Het
Chil1 T A 1: 134,182,258 M1K probably null Het
Crybg2 T C 4: 134,081,426 S1404P probably damaging Het
Cubn C A 2: 13,280,195 C3470F probably damaging Het
Cyp20a1 T C 1: 60,352,172 probably null Het
Cyp24a1 G T 2: 170,486,784 T408K probably benign Het
Cyp2a12 A T 7: 27,031,152 I181F possibly damaging Het
Dnm1l A T 16: 16,332,088 I268N probably damaging Het
Eif2a A G 3: 58,557,096 probably null Het
Epg5 T C 18: 77,962,398 F701S probably damaging Het
Fbxo46 T C 7: 19,136,541 S362P possibly damaging Het
Fgf22 A G 10: 79,756,996 probably benign Het
Fhod1 A C 8: 105,337,350 probably benign Het
Flnc T A 6: 29,459,063 V2448D probably damaging Het
Gm2696 G T 10: 77,836,138 probably benign Het
Gmpr T C 13: 45,532,398 S214P possibly damaging Het
Krt6a A G 15: 101,692,309 V308A probably damaging Het
Lig3 T A 11: 82,794,007 probably null Het
Lrrc37a T A 11: 103,504,051 N183Y probably benign Het
Mapk8ip3 C A 17: 24,906,905 G422V probably damaging Het
Mks1 T C 11: 87,855,499 S97P probably benign Het
Mphosph9 A T 5: 124,324,961 V7E probably damaging Het
Msh5 A G 17: 35,029,924 L711P probably damaging Het
Naga T A 15: 82,332,203 probably null Het
Nlrp10 T A 7: 108,925,746 T176S possibly damaging Het
Nqo1 T C 8: 107,388,950 N232D probably benign Het
Olfr11 T A 13: 21,639,248 I92L probably damaging Het
Olfr50 C G 2: 36,793,573 N112K possibly damaging Het
P2ry6 A G 7: 100,938,396 F252S probably damaging Het
P3h3 G A 6: 124,854,872 R317W probably benign Het
Palm2 T A 4: 57,710,173 C373S probably damaging Het
Pdzd3 A G 9: 44,248,683 V380A probably benign Het
Phkb T A 8: 85,875,698 D39E probably benign Het
Psg16 G A 7: 17,088,187 G23D probably damaging Het
Ptgr2 T A 12: 84,302,337 I150K probably benign Het
Ptprf A G 4: 118,212,814 V1457A probably benign Het
Sart3 A T 5: 113,751,240 Y508N probably benign Het
Sh3bp1 C T 15: 78,911,515 P615S probably damaging Het
Ska3 A T 14: 57,816,691 N267K probably benign Het
Slc26a7 A G 4: 14,524,498 I462T probably benign Het
Slu7 C T 11: 43,441,489 A244V probably benign Het
Smarca4 C T 9: 21,637,375 P319L probably damaging Het
Smg9 A G 7: 24,420,861 D420G probably benign Het
Syne2 T G 12: 76,061,650 V936G probably damaging Het
Tbc1d7 C T 13: 43,152,933 probably benign Het
Terb1 C A 8: 104,447,199 D751Y probably damaging Het
Trpc1 A G 9: 95,721,250 Y410H probably damaging Het
Ush2a A G 1: 188,356,846 N333D probably benign Het
Usp34 T C 11: 23,452,520 S2438P probably damaging Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp7 G A 15: 76,890,610 G284D possibly damaging Het
Zfyve26 A G 12: 79,240,002 S2271P probably damaging Het
Zscan18 G A 7: 12,775,220 probably benign Het
Other mutations in Strc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Strc APN 2 121365060 missense probably benign 0.39
IGL01152:Strc APN 2 121370795 missense probably benign
IGL01608:Strc APN 2 121375594 missense probably benign 0.05
IGL01695:Strc APN 2 121375298 missense probably damaging 1.00
IGL01715:Strc APN 2 121365737 splice site probably null
IGL01906:Strc APN 2 121377634 missense probably benign
IGL02135:Strc APN 2 121364834 missense probably damaging 1.00
IGL02416:Strc APN 2 121369058 missense probably damaging 1.00
IGL02455:Strc APN 2 121375791 unclassified probably benign
IGL03029:Strc APN 2 121364044 missense possibly damaging 0.95
IGL03176:Strc APN 2 121372180 missense probably damaging 0.99
IGL03272:Strc APN 2 121371751 missense probably damaging 1.00
3-1:Strc UTSW 2 121373680 missense probably damaging 0.99
IGL02799:Strc UTSW 2 121379236 missense probably damaging 1.00
PIT4283001:Strc UTSW 2 121375307 missense probably damaging 1.00
R0022:Strc UTSW 2 121368393 missense probably damaging 1.00
R0494:Strc UTSW 2 121379533 missense probably damaging 0.99
R1065:Strc UTSW 2 121366651 missense probably damaging 1.00
R1148:Strc UTSW 2 121372077 intron probably benign
R1148:Strc UTSW 2 121372077 intron probably benign
R1203:Strc UTSW 2 121372123 missense possibly damaging 0.66
R1343:Strc UTSW 2 121365115 missense probably benign 0.21
R1544:Strc UTSW 2 121372738 splice site probably null
R1650:Strc UTSW 2 121380885 start gained probably benign
R1840:Strc UTSW 2 121379296 missense probably damaging 1.00
R1983:Strc UTSW 2 121371037 missense possibly damaging 0.54
R2035:Strc UTSW 2 121374934 missense probably damaging 1.00
R2058:Strc UTSW 2 121378887 missense probably damaging 1.00
R2158:Strc UTSW 2 121365862 missense probably benign 0.10
R2219:Strc UTSW 2 121364523 missense probably damaging 1.00
R2680:Strc UTSW 2 121365111 missense probably damaging 0.99
R4375:Strc UTSW 2 121380823 missense unknown
R4563:Strc UTSW 2 121365805 missense probably benign 0.02
R4578:Strc UTSW 2 121378003 missense possibly damaging 0.94
R4607:Strc UTSW 2 121372945 missense probably benign 0.31
R4651:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4652:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4790:Strc UTSW 2 121375594 missense probably benign 0.05
R5480:Strc UTSW 2 121364819 missense probably benign 0.00
R5580:Strc UTSW 2 121375012 missense probably damaging 0.99
R5679:Strc UTSW 2 121368100 missense probably benign 0.03
R5703:Strc UTSW 2 121370814 missense probably benign
R5841:Strc UTSW 2 121365877 missense probably benign 0.29
R5917:Strc UTSW 2 121379309 missense probably benign
R5958:Strc UTSW 2 121376922 missense possibly damaging 0.56
R6619:Strc UTSW 2 121368432 missense probably damaging 0.99
R6695:Strc UTSW 2 121377224 missense probably benign 0.35
R6970:Strc UTSW 2 121378014 missense probably benign 0.41
R7018:Strc UTSW 2 121369058 missense probably damaging 1.00
R7045:Strc UTSW 2 121370726 missense probably damaging 1.00
R7190:Strc UTSW 2 121369026 missense probably benign 0.14
R7283:Strc UTSW 2 121379452 missense probably damaging 0.99
R7694:Strc UTSW 2 121377096 missense probably damaging 1.00
R7699:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7700:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7756:Strc UTSW 2 121370946 missense probably benign
R7758:Strc UTSW 2 121370946 missense probably benign
R7822:Strc UTSW 2 121377738 missense probably benign 0.01
R7830:Strc UTSW 2 121375049 missense probably damaging 0.99
R7953:Strc UTSW 2 121377363 missense probably damaging 0.99
R8137:Strc UTSW 2 121366738 missense probably damaging 0.98
R8394:Strc UTSW 2 121379009 missense probably benign 0.00
R8427:Strc UTSW 2 121377531 missense probably damaging 1.00
Z1176:Strc UTSW 2 121375521 missense probably damaging 0.98
Z1176:Strc UTSW 2 121379044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGCTACTGGCCAGCTATC -3'
(R):5'- TACAGAGAGGTCCCTTTCAGG -3'

Sequencing Primer
(F):5'- CAGGGCCTGGATCTGAGATG -3'
(R):5'- GAGACTCTCCTTCCTGTCCACAG -3'
Posted On2018-04-02