Incidental Mutation 'R6322:Nkx1-1'
ID510147
Institutional Source Beutler Lab
Gene Symbol Nkx1-1
Ensembl Gene ENSMUSG00000029112
Gene NameNK1 homeobox 1
SynonymsNkx-1.1, Sax2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.853) question?
Stock #R6322 (G1)
Quality Score108.008
Status Validated
Chromosome5
Chromosomal Location33430734-33433976 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33431045 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 300 (N300D)
Ref Sequence ENSEMBL: ENSMUSP00000133620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173348]
Predicted Effect probably damaging
Transcript: ENSMUST00000173348
AA Change: N300D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133620
Gene: ENSMUSG00000029112
AA Change: N300D

DomainStartEndE-ValueType
low complexity region 24 42 N/A INTRINSIC
low complexity region 68 88 N/A INTRINSIC
low complexity region 94 120 N/A INTRINSIC
low complexity region 146 160 N/A INTRINSIC
low complexity region 166 187 N/A INTRINSIC
low complexity region 199 231 N/A INTRINSIC
HOX 250 312 2.74e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene show poor growth and survival. Most die within the first three weeks of life. Those that reach adulthood are fertile but do not produce viable offspring. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,729,499 V211A probably benign Het
Adora3 G A 3: 105,907,444 R170H probably benign Het
Aldh1l1 T C 6: 90,562,698 I203T probably benign Het
Alox12b T C 11: 69,158,373 Y83H possibly damaging Het
Atcay A T 10: 81,213,291 I159K probably damaging Het
Blvra A G 2: 127,080,539 probably benign Het
Celsr2 A G 3: 108,412,574 F974S probably damaging Het
Cfap44 C T 16: 44,433,666 R918* probably null Het
Cpa6 T A 1: 10,477,121 R181S possibly damaging Het
Dlg1 A G 16: 31,856,479 N730D probably damaging Het
Eif2ak1 A G 5: 143,899,095 T535A probably benign Het
Fam13c A T 10: 70,498,891 D149V probably damaging Het
Fam171a1 G A 2: 3,226,355 V717I probably benign Het
Fchsd1 A G 18: 37,965,700 V290A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm15446 A T 5: 109,943,517 H545L probably damaging Het
Gm16432 T A 1: 178,017,730 Y105* probably null Het
Heatr9 T G 11: 83,516,712 K215T possibly damaging Het
Hfe T A 13: 23,705,896 H210L probably damaging Het
Lama2 T C 10: 27,190,547 T1113A probably damaging Het
Lipe A T 7: 25,380,536 V686E probably damaging Het
Map3k20 T G 2: 72,433,470 L488V possibly damaging Het
Moxd1 C T 10: 24,284,811 T454I probably damaging Het
Mrpl58 C T 11: 115,410,666 R189* probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nrm A T 17: 35,864,713 Q237L possibly damaging Het
Numa1 T C 7: 102,000,920 L1286P probably damaging Het
Olfr1291-ps1 T C 2: 111,499,384 F44S possibly damaging Het
Pappa C A 4: 65,314,659 A1345D probably damaging Het
Pds5a T C 5: 65,696,834 I22V probably benign Het
Phf21b C A 15: 84,787,379 R438L possibly damaging Het
Pik3r5 T C 11: 68,492,741 L462P probably benign Het
Plagl2 T C 2: 153,231,886 E365G probably benign Het
Plxna2 A G 1: 194,754,367 Y677C possibly damaging Het
Pramef12 A G 4: 144,392,905 M364T probably benign Het
Prkcd C A 14: 30,599,663 G410W probably damaging Het
Rgl1 T C 1: 152,552,435 I348V probably damaging Het
Rnmt C T 18: 68,319,214 P386S probably damaging Het
Rtn3 G A 19: 7,458,138 P163L possibly damaging Het
Sfxn1 T C 13: 54,104,850 C275R possibly damaging Het
Sh2b2 A G 5: 136,224,188 S377P probably damaging Het
Sh3bp1 C T 15: 78,911,515 P615S probably damaging Het
Simc1 T C 13: 54,550,569 L1334S probably damaging Het
Slc9a2 C A 1: 40,742,653 Y347* probably null Het
Snapc5 T A 9: 64,182,173 I71K probably damaging Het
Tmem161a T C 8: 70,182,114 F447S probably damaging Het
Tns3 A G 11: 8,492,147 C739R probably benign Het
Trappc11 A T 8: 47,530,773 V28D possibly damaging Het
Ubr3 C T 2: 69,956,085 Q848* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Other mutations in Nkx1-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1826:Nkx1-1 UTSW 5 33433933 missense unknown
R2175:Nkx1-1 UTSW 5 33431254 missense probably benign 0.10
R3735:Nkx1-1 UTSW 5 33433730 missense unknown
R4973:Nkx1-1 UTSW 5 33431066 missense possibly damaging 0.89
R6155:Nkx1-1 UTSW 5 33431051 missense probably damaging 1.00
R6381:Nkx1-1 UTSW 5 33433976 start codon destroyed probably null
R6675:Nkx1-1 UTSW 5 33433879 missense unknown
R6831:Nkx1-1 UTSW 5 33433803 missense unknown
Z1177:Nkx1-1 UTSW 5 33431495 missense unknown
Predicted Primers PCR Primer
(F):5'- TTAGAAAAGAGACGCCCATGC -3'
(R):5'- TTCCCCTGTGGACGATACTG -3'

Sequencing Primer
(F):5'- TCCTGGCACCGAGATTCAGAG -3'
(R):5'- CTGCAACTGCTACGGGAG -3'
Posted On2018-04-02