Incidental Mutation 'R6322:Eif2ak1'
ID510152
Institutional Source Beutler Lab
Gene Symbol Eif2ak1
Ensembl Gene ENSMUSG00000029613
Gene Nameeukaryotic translation initiation factor 2 alpha kinase 1
SynonymsHri
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R6322 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location143817788-143904251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143899095 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 535 (T535A)
Ref Sequence ENSEMBL: ENSMUSP00000098056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031613] [ENSMUST00000079624] [ENSMUST00000100483] [ENSMUST00000100487] [ENSMUST00000110717] [ENSMUST00000110718]
Predicted Effect probably benign
Transcript: ENSMUST00000031613
SMART Domains Protein: ENSMUSP00000031613
Gene: ENSMUSG00000029610

DomainStartEndE-ValueType
Pfam:AIMP2_LysRS_bd 1 44 8.3e-26 PFAM
low complexity region 133 142 N/A INTRINSIC
Pfam:GST_C_3 231 308 2.5e-10 PFAM
Pfam:GST_C 242 310 5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079624
SMART Domains Protein: ENSMUSP00000078571
Gene: ENSMUSG00000029607

DomainStartEndE-ValueType
ANK 36 61 2.55e2 SMART
ANK 65 118 8.5e2 SMART
ANK 124 153 1.27e-2 SMART
ANK 157 186 7.95e-4 SMART
ANK 191 230 3.74e0 SMART
ANK 234 263 3.46e-4 SMART
Blast:ANK 267 300 4e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000100483
SMART Domains Protein: ENSMUSP00000098052
Gene: ENSMUSG00000029610

DomainStartEndE-ValueType
low complexity region 93 102 N/A INTRINSIC
Pfam:GST_C_3 185 268 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100487
AA Change: T535A

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000098056
Gene: ENSMUSG00000029613
AA Change: T535A

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 62 81 N/A INTRINSIC
Pfam:Pkinase_Tyr 167 242 5.6e-6 PFAM
Pfam:Pkinase 167 257 1.9e-15 PFAM
low complexity region 314 320 N/A INTRINSIC
Pfam:Pkinase 365 580 1.3e-31 PFAM
Pfam:Pkinase_Tyr 373 578 1.9e-19 PFAM
coiled coil region 585 619 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110717
SMART Domains Protein: ENSMUSP00000106345
Gene: ENSMUSG00000029607

DomainStartEndE-ValueType
Blast:ANK 28 57 6e-11 BLAST
ANK 78 103 1.6e0 SMART
ANK 107 160 5.6e0 SMART
ANK 166 195 8.4e-5 SMART
ANK 199 228 5.3e-6 SMART
ANK 233 272 2.4e-2 SMART
ANK 276 305 2.3e-6 SMART
Blast:ANK 309 342 5e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000110718
SMART Domains Protein: ENSMUSP00000106346
Gene: ENSMUSG00000029607

DomainStartEndE-ValueType
ANK 35 60 2.55e2 SMART
ANK 64 117 8.5e2 SMART
ANK 123 152 1.27e-2 SMART
ANK 156 185 7.95e-4 SMART
ANK 190 229 3.74e0 SMART
ANK 233 262 3.46e-4 SMART
Blast:ANK 266 299 4e-11 BLAST
Meta Mutation Damage Score 0.1024 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts at the level of translation initiation to downregulate protein synthesis in response to stress. The encoded protein is a kinase that can be inactivated by hemin. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit enlarged heart size and abnormal red blood cell development, morphology, and physiology with macrocytic anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,729,499 V211A probably benign Het
Adora3 G A 3: 105,907,444 R170H probably benign Het
Aldh1l1 T C 6: 90,562,698 I203T probably benign Het
Alox12b T C 11: 69,158,373 Y83H possibly damaging Het
Atcay A T 10: 81,213,291 I159K probably damaging Het
Blvra A G 2: 127,080,539 probably benign Het
Celsr2 A G 3: 108,412,574 F974S probably damaging Het
Cfap44 C T 16: 44,433,666 R918* probably null Het
Cpa6 T A 1: 10,477,121 R181S possibly damaging Het
Dlg1 A G 16: 31,856,479 N730D probably damaging Het
Fam13c A T 10: 70,498,891 D149V probably damaging Het
Fam171a1 G A 2: 3,226,355 V717I probably benign Het
Fchsd1 A G 18: 37,965,700 V290A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm15446 A T 5: 109,943,517 H545L probably damaging Het
Gm16432 T A 1: 178,017,730 Y105* probably null Het
Heatr9 T G 11: 83,516,712 K215T possibly damaging Het
Hfe T A 13: 23,705,896 H210L probably damaging Het
Lama2 T C 10: 27,190,547 T1113A probably damaging Het
Lipe A T 7: 25,380,536 V686E probably damaging Het
Map3k20 T G 2: 72,433,470 L488V possibly damaging Het
Moxd1 C T 10: 24,284,811 T454I probably damaging Het
Mrpl58 C T 11: 115,410,666 R189* probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nkx1-1 T C 5: 33,431,045 N300D probably damaging Het
Nrm A T 17: 35,864,713 Q237L possibly damaging Het
Numa1 T C 7: 102,000,920 L1286P probably damaging Het
Olfr1291-ps1 T C 2: 111,499,384 F44S possibly damaging Het
Pappa C A 4: 65,314,659 A1345D probably damaging Het
Pds5a T C 5: 65,696,834 I22V probably benign Het
Phf21b C A 15: 84,787,379 R438L possibly damaging Het
Pik3r5 T C 11: 68,492,741 L462P probably benign Het
Plagl2 T C 2: 153,231,886 E365G probably benign Het
Plxna2 A G 1: 194,754,367 Y677C possibly damaging Het
Pramef12 A G 4: 144,392,905 M364T probably benign Het
Prkcd C A 14: 30,599,663 G410W probably damaging Het
Rgl1 T C 1: 152,552,435 I348V probably damaging Het
Rnmt C T 18: 68,319,214 P386S probably damaging Het
Rtn3 G A 19: 7,458,138 P163L possibly damaging Het
Sfxn1 T C 13: 54,104,850 C275R possibly damaging Het
Sh2b2 A G 5: 136,224,188 S377P probably damaging Het
Sh3bp1 C T 15: 78,911,515 P615S probably damaging Het
Simc1 T C 13: 54,550,569 L1334S probably damaging Het
Slc9a2 C A 1: 40,742,653 Y347* probably null Het
Snapc5 T A 9: 64,182,173 I71K probably damaging Het
Tmem161a T C 8: 70,182,114 F447S probably damaging Het
Tns3 A G 11: 8,492,147 C739R probably benign Het
Trappc11 A T 8: 47,530,773 V28D possibly damaging Het
Ubr3 C T 2: 69,956,085 Q848* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Other mutations in Eif2ak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Eif2ak1 APN 5 143889470 missense probably damaging 0.99
IGL02170:Eif2ak1 APN 5 143879460 missense probably benign 0.01
IGL02472:Eif2ak1 APN 5 143884883 missense probably benign 0.00
IGL02898:Eif2ak1 APN 5 143889452 missense probably damaging 1.00
IGL03078:Eif2ak1 APN 5 143873769 missense probably benign 0.02
PIT4520001:Eif2ak1 UTSW 5 143899209 nonsense probably null
R0523:Eif2ak1 UTSW 5 143882166 missense probably damaging 1.00
R0755:Eif2ak1 UTSW 5 143884924 missense possibly damaging 0.94
R1128:Eif2ak1 UTSW 5 143899176 unclassified probably null
R1203:Eif2ak1 UTSW 5 143883979 missense probably benign 0.00
R1445:Eif2ak1 UTSW 5 143873899 splice site probably benign
R1474:Eif2ak1 UTSW 5 143871967 missense probably damaging 1.00
R1972:Eif2ak1 UTSW 5 143884714 missense probably benign 0.04
R3885:Eif2ak1 UTSW 5 143884661 missense probably benign 0.21
R3889:Eif2ak1 UTSW 5 143884661 missense probably benign 0.21
R4754:Eif2ak1 UTSW 5 143901803 missense probably damaging 0.99
R4971:Eif2ak1 UTSW 5 143882168 missense probably damaging 1.00
R5007:Eif2ak1 UTSW 5 143873880 missense probably benign
R5487:Eif2ak1 UTSW 5 143897163 critical splice acceptor site probably null
R5505:Eif2ak1 UTSW 5 143817990 missense probably benign
R5808:Eif2ak1 UTSW 5 143883994 missense probably benign 0.21
R5888:Eif2ak1 UTSW 5 143886915 missense probably damaging 1.00
R6290:Eif2ak1 UTSW 5 143884799 missense probably benign 0.34
R6475:Eif2ak1 UTSW 5 143818010 unclassified probably null
R7343:Eif2ak1 UTSW 5 143877671 missense probably damaging 1.00
R7525:Eif2ak1 UTSW 5 143886898 missense probably damaging 1.00
R7554:Eif2ak1 UTSW 5 143879478 missense probably damaging 1.00
R7659:Eif2ak1 UTSW 5 143889462 missense probably damaging 1.00
X0027:Eif2ak1 UTSW 5 143879435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAAGGCCTCCTCCATGCATC -3'
(R):5'- GACTGACTCTTGGAATCATACCC -3'

Sequencing Primer
(F):5'- GCATCCTTACTTGAGAGACTGTACTG -3'
(R):5'- TGACTCTTGGAATCATACCCAACCC -3'
Posted On2018-04-02