Incidental Mutation 'R6322:Gm11595'
ID510167
Institutional Source Beutler Lab
Gene Symbol Gm11595
Ensembl Gene ENSMUSG00000078668
Gene Namepredicted gene 11595
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6322 (G1)
Quality Score212.009
Status Validated
Chromosome11
Chromosomal Location99771714-99772913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99772555 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 100 (R100C)
Ref Sequence ENSEMBL: ENSMUSP00000103064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107440]
Predicted Effect unknown
Transcript: ENSMUST00000107440
AA Change: R100C
SMART Domains Protein: ENSMUSP00000103064
Gene: ENSMUSG00000078668
AA Change: R100C

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 47 7.5e-9 PFAM
Pfam:Keratin_B2_2 14 58 2.8e-13 PFAM
Pfam:Keratin_B2_2 29 73 1.2e-13 PFAM
Pfam:Keratin_B2_2 72 112 2.3e-12 PFAM
Pfam:Keratin_B2_2 107 152 4.6e-14 PFAM
Pfam:Keratin_B2_2 118 162 1.1e-13 PFAM
Pfam:Keratin_B2_2 143 187 3.5e-10 PFAM
Pfam:Keratin_B2_2 168 212 5.6e-13 PFAM
Pfam:Keratin_B2_2 178 222 2.4e-12 PFAM
Pfam:Keratin_B2_2 208 257 1.6e-11 PFAM
Pfam:Keratin_B2_2 223 267 4e-14 PFAM
Pfam:Keratin_B2_2 248 289 9e-9 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,729,499 V211A probably benign Het
Adora3 G A 3: 105,907,444 R170H probably benign Het
Aldh1l1 T C 6: 90,562,698 I203T probably benign Het
Alox12b T C 11: 69,158,373 Y83H possibly damaging Het
Atcay A T 10: 81,213,291 I159K probably damaging Het
Blvra A G 2: 127,080,539 probably benign Het
Celsr2 A G 3: 108,412,574 F974S probably damaging Het
Cfap44 C T 16: 44,433,666 R918* probably null Het
Cpa6 T A 1: 10,477,121 R181S possibly damaging Het
Dlg1 A G 16: 31,856,479 N730D probably damaging Het
Eif2ak1 A G 5: 143,899,095 T535A probably benign Het
Fam13c A T 10: 70,498,891 D149V probably damaging Het
Fam171a1 G A 2: 3,226,355 V717I probably benign Het
Fchsd1 A G 18: 37,965,700 V290A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm15446 A T 5: 109,943,517 H545L probably damaging Het
Gm16432 T A 1: 178,017,730 Y105* probably null Het
Heatr9 T G 11: 83,516,712 K215T possibly damaging Het
Hfe T A 13: 23,705,896 H210L probably damaging Het
Lama2 T C 10: 27,190,547 T1113A probably damaging Het
Lipe A T 7: 25,380,536 V686E probably damaging Het
Map3k20 T G 2: 72,433,470 L488V possibly damaging Het
Moxd1 C T 10: 24,284,811 T454I probably damaging Het
Mrpl58 C T 11: 115,410,666 R189* probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nkx1-1 T C 5: 33,431,045 N300D probably damaging Het
Nrm A T 17: 35,864,713 Q237L possibly damaging Het
Numa1 T C 7: 102,000,920 L1286P probably damaging Het
Olfr1291-ps1 T C 2: 111,499,384 F44S possibly damaging Het
Pappa C A 4: 65,314,659 A1345D probably damaging Het
Pds5a T C 5: 65,696,834 I22V probably benign Het
Phf21b C A 15: 84,787,379 R438L possibly damaging Het
Pik3r5 T C 11: 68,492,741 L462P probably benign Het
Plagl2 T C 2: 153,231,886 E365G probably benign Het
Plxna2 A G 1: 194,754,367 Y677C possibly damaging Het
Pramef12 A G 4: 144,392,905 M364T probably benign Het
Prkcd C A 14: 30,599,663 G410W probably damaging Het
Rgl1 T C 1: 152,552,435 I348V probably damaging Het
Rnmt C T 18: 68,319,214 P386S probably damaging Het
Rtn3 G A 19: 7,458,138 P163L possibly damaging Het
Sfxn1 T C 13: 54,104,850 C275R possibly damaging Het
Sh2b2 A G 5: 136,224,188 S377P probably damaging Het
Sh3bp1 C T 15: 78,911,515 P615S probably damaging Het
Simc1 T C 13: 54,550,569 L1334S probably damaging Het
Slc9a2 C A 1: 40,742,653 Y347* probably null Het
Snapc5 T A 9: 64,182,173 I71K probably damaging Het
Tmem161a T C 8: 70,182,114 F447S probably damaging Het
Tns3 A G 11: 8,492,147 C739R probably benign Het
Trappc11 A T 8: 47,530,773 V28D possibly damaging Het
Ubr3 C T 2: 69,956,085 Q848* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Other mutations in Gm11595
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gm11595 APN 11 99772042 missense unknown
IGL00987:Gm11595 APN 11 99772539 missense unknown
IGL01662:Gm11595 APN 11 99772672 missense unknown
IGL01994:Gm11595 APN 11 99772201 missense unknown
R0548:Gm11595 UTSW 11 99772141 missense unknown
R1923:Gm11595 UTSW 11 99772539 missense unknown
R2127:Gm11595 UTSW 11 99772501 missense unknown
R2128:Gm11595 UTSW 11 99772501 missense unknown
R3807:Gm11595 UTSW 11 99772554 missense unknown
R4007:Gm11595 UTSW 11 99772035 missense unknown
R5281:Gm11595 UTSW 11 99772555 missense unknown
R5283:Gm11595 UTSW 11 99772555 missense unknown
R5303:Gm11595 UTSW 11 99772555 missense unknown
R5305:Gm11595 UTSW 11 99772555 missense unknown
R5306:Gm11595 UTSW 11 99772555 missense unknown
R5307:Gm11595 UTSW 11 99772555 missense unknown
R5308:Gm11595 UTSW 11 99772555 missense unknown
R5561:Gm11595 UTSW 11 99772555 missense unknown
R5637:Gm11595 UTSW 11 99772555 missense unknown
R5639:Gm11595 UTSW 11 99772555 missense unknown
R5718:Gm11595 UTSW 11 99772555 missense unknown
R5719:Gm11595 UTSW 11 99772555 missense unknown
R5720:Gm11595 UTSW 11 99772555 missense unknown
R5721:Gm11595 UTSW 11 99772555 missense unknown
R5769:Gm11595 UTSW 11 99772555 missense unknown
R5770:Gm11595 UTSW 11 99772555 missense unknown
R5771:Gm11595 UTSW 11 99772555 missense unknown
R5791:Gm11595 UTSW 11 99772555 missense unknown
R5841:Gm11595 UTSW 11 99772317 missense unknown
R6054:Gm11595 UTSW 11 99772648 missense unknown
R6277:Gm11595 UTSW 11 99772684 missense unknown
R6281:Gm11595 UTSW 11 99772555 missense unknown
R6282:Gm11595 UTSW 11 99772555 missense unknown
R6310:Gm11595 UTSW 11 99772555 missense unknown
R6321:Gm11595 UTSW 11 99772555 missense unknown
R6327:Gm11595 UTSW 11 99772555 missense unknown
R6337:Gm11595 UTSW 11 99772555 missense unknown
R6368:Gm11595 UTSW 11 99772555 missense unknown
R6369:Gm11595 UTSW 11 99772555 missense unknown
R6431:Gm11595 UTSW 11 99772774 missense unknown
R6483:Gm11595 UTSW 11 99772555 missense unknown
R6485:Gm11595 UTSW 11 99772555 missense unknown
R6493:Gm11595 UTSW 11 99772555 missense unknown
R6758:Gm11595 UTSW 11 99772540 missense unknown
R6758:Gm11595 UTSW 11 99772541 nonsense probably null
R7037:Gm11595 UTSW 11 99772648 missense unknown
R8053:Gm11595 UTSW 11 99772128 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGAACTACCACAGCAGGGG -3'
(R):5'- ACCATGGTCAGTTCCTGTTG -3'

Sequencing Primer
(F):5'- CGACAGCAGCTGGAGATG -3'
(R):5'- TGCCAGACCACCTGCTGTAG -3'
Posted On2018-04-02