Incidental Mutation 'R6323:Rnf2'
ID510183
Institutional Source Beutler Lab
Gene Symbol Rnf2
Ensembl Gene ENSMUSG00000026484
Gene Namering finger protein 2
SynonymsdinG, Ring1B
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6323 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location151458004-151500955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 151473216 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 51 (K51R)
Ref Sequence ENSEMBL: ENSMUSP00000139676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076110] [ENSMUST00000186415] [ENSMUST00000187048] [ENSMUST00000187991] [ENSMUST00000190070]
Predicted Effect probably benign
Transcript: ENSMUST00000076110
AA Change: K198R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000075476
Gene: ENSMUSG00000026484
AA Change: K198R

DomainStartEndE-ValueType
RING 51 90 1.7e-7 SMART
Pfam:RAWUL 234 330 1.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185945
Predicted Effect probably benign
Transcript: ENSMUST00000186415
AA Change: K126R

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140594
Gene: ENSMUSG00000026484
AA Change: K126R

DomainStartEndE-ValueType
RING 51 110 3.24e-4 SMART
PDB:3H8H|A 148 258 4e-78 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000187048
AA Change: K198R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000140896
Gene: ENSMUSG00000026484
AA Change: K198R

DomainStartEndE-ValueType
RING 51 90 1.7e-7 SMART
PDB:3H8H|A 220 330 4e-77 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000187991
SMART Domains Protein: ENSMUSP00000140299
Gene: ENSMUSG00000026484

DomainStartEndE-ValueType
Pfam:zf-C3HC4 51 73 2.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188871
Predicted Effect probably damaging
Transcript: ENSMUST00000190070
AA Change: K51R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139676
Gene: ENSMUSG00000026484
AA Change: K51R

DomainStartEndE-ValueType
Blast:RING 1 35 7e-16 BLAST
PDB:3H8H|A 73 156 2e-56 PDB
Meta Mutation Damage Score 0.0639 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polycomb group (PcG) of proteins form the multiprotein complexes that are important for the transcription repression of various genes involved in development and cell proliferation. The protein encoded by this gene is one of the PcG proteins. It has been shown to interact with, and suppress the activity of, transcription factor CP2 (TFCP2/CP2). Studies of the mouse counterpart suggested the involvement of this gene in the specification of anterior-posterior axis, as well as in cell proliferation in early development. This protein was also found to interact with huntingtin interacting protein 2 (HIP2), an ubiquitin-conjugating enzyme, and possess ubiquitin ligase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a null allele show an early growth arrest, failure to progress through gastrulation, impaired epiblast expansion, accumulation of posterior mesoderm and die before E10.5. Mice homozygous for a hypomorphic allele show posterior homeotic transformations of the axial skeleton. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,283,082 T4698I probably benign Het
4933409G03Rik A G 2: 68,606,224 T171A unknown Het
Akr1c6 A G 13: 4,447,018 K153R possibly damaging Het
Ano1 T A 7: 144,611,686 I601F possibly damaging Het
Arfgef2 A G 2: 166,834,484 Y8C probably damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2a A G 10: 128,126,417 I1816V probably benign Het
Cadps2 T A 6: 23,263,578 T1294S probably benign Het
Casz1 T C 4: 148,941,704 S952P possibly damaging Het
Cdc20 T C 4: 118,435,564 N329S probably damaging Het
Ceacam1 A C 7: 25,474,651 L193R probably damaging Het
Celf5 A G 10: 81,469,503 S143P probably damaging Het
Cfap74 A G 4: 155,463,938 D1342G possibly damaging Het
Chd5 C A 4: 152,367,334 T701K probably damaging Het
Cpt1b C A 15: 89,419,063 M596I probably benign Het
Ctrb1 A G 8: 111,689,591 V21A probably benign Het
Diaph3 C T 14: 86,966,453 V579I probably benign Het
Dlc1 T C 8: 36,938,383 E84G possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Galns T C 8: 122,598,651 D254G probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gstm1 A G 3: 108,017,747 V10A probably benign Het
Krt13 C A 11: 100,121,150 A116S probably damaging Het
Lars2 A T 9: 123,441,594 K584* probably null Het
Lrrc43 G T 5: 123,503,886 G600W probably damaging Het
Madd G T 2: 91,161,438 probably null Het
Mnat1 A G 12: 73,168,104 D65G probably damaging Het
Nsmf A G 2: 25,055,051 N42S possibly damaging Het
Olfr1283 T C 2: 111,368,701 L23P possibly damaging Het
Olfr198 A G 16: 59,202,282 L48P probably damaging Het
Palld A T 8: 61,720,693 W311R probably damaging Het
Pax1 T A 2: 147,368,401 V352E probably damaging Het
Rpl7l1 C A 17: 46,782,638 probably benign Het
Slc17a2 A G 13: 23,814,986 I121V probably benign Het
Slc1a6 G A 10: 78,812,887 G481S probably damaging Het
Trav6-1 T C 14: 52,638,791 V56A possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r79 T A 7: 87,001,314 C103S probably benign Het
Wwp2 A T 8: 107,540,671 H305L probably damaging Het
Zfp593 A G 4: 134,244,913 V94A probably benign Het
Other mutations in Rnf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02515:Rnf2 APN 1 151471695 missense probably benign 0.03
R1913:Rnf2 UTSW 1 151476185 missense probably damaging 1.00
R4333:Rnf2 UTSW 1 151473076 missense possibly damaging 0.68
R4965:Rnf2 UTSW 1 151473217 nonsense probably null
R6886:Rnf2 UTSW 1 151473266 missense possibly damaging 0.85
R7386:Rnf2 UTSW 1 151471380 missense probably damaging 1.00
R7474:Rnf2 UTSW 1 151471716 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCATACACAGACCGTTCTCTGAAAC -3'
(R):5'- CAAAATGGTTTCAAGTTTGACGCC -3'

Sequencing Primer
(F):5'- CTGAAACCTTGTGCAACCATGTG -3'
(R):5'- GGTTTCAAGTTTGACGCCTTAAAG -3'
Posted On2018-04-02