Incidental Mutation 'R6323:Olfr1283'
ID510187
Institutional Source Beutler Lab
Gene Symbol Olfr1283
Ensembl Gene ENSMUSG00000109322
Gene Nameolfactory receptor 1283
SynonymsGA_x6K02T2Q125-72420217-72421134, MOR248-19
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.673) question?
Stock #R6323 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111366790-111370063 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111368701 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 23 (L23P)
Ref Sequence ENSEMBL: ENSMUSP00000150510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090328] [ENSMUST00000204064] [ENSMUST00000216637]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090328
AA Change: L23P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087800
Gene: ENSMUSG00000109322
AA Change: L23P

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 3.6e-49 PFAM
Pfam:7tm_1 41 287 3.9e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204064
AA Change: L23P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145495
Gene: ENSMUSG00000109322
AA Change: L23P

DomainStartEndE-ValueType
Pfam:7tm_4 30 298 2.1e-39 PFAM
Pfam:7tm_1 40 286 7.8e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216637
AA Change: L23P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.3762 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,283,082 T4698I probably benign Het
4933409G03Rik A G 2: 68,606,224 T171A unknown Het
Akr1c6 A G 13: 4,447,018 K153R possibly damaging Het
Ano1 T A 7: 144,611,686 I601F possibly damaging Het
Arfgef2 A G 2: 166,834,484 Y8C probably damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2a A G 10: 128,126,417 I1816V probably benign Het
Cadps2 T A 6: 23,263,578 T1294S probably benign Het
Casz1 T C 4: 148,941,704 S952P possibly damaging Het
Cdc20 T C 4: 118,435,564 N329S probably damaging Het
Ceacam1 A C 7: 25,474,651 L193R probably damaging Het
Celf5 A G 10: 81,469,503 S143P probably damaging Het
Cfap74 A G 4: 155,463,938 D1342G possibly damaging Het
Chd5 C A 4: 152,367,334 T701K probably damaging Het
Cpt1b C A 15: 89,419,063 M596I probably benign Het
Ctrb1 A G 8: 111,689,591 V21A probably benign Het
Diaph3 C T 14: 86,966,453 V579I probably benign Het
Dlc1 T C 8: 36,938,383 E84G possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Galns T C 8: 122,598,651 D254G probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gstm1 A G 3: 108,017,747 V10A probably benign Het
Krt13 C A 11: 100,121,150 A116S probably damaging Het
Lars2 A T 9: 123,441,594 K584* probably null Het
Lrrc43 G T 5: 123,503,886 G600W probably damaging Het
Madd G T 2: 91,161,438 probably null Het
Mnat1 A G 12: 73,168,104 D65G probably damaging Het
Nsmf A G 2: 25,055,051 N42S possibly damaging Het
Olfr198 A G 16: 59,202,282 L48P probably damaging Het
Palld A T 8: 61,720,693 W311R probably damaging Het
Pax1 T A 2: 147,368,401 V352E probably damaging Het
Rnf2 T C 1: 151,473,216 K51R probably damaging Het
Rpl7l1 C A 17: 46,782,638 probably benign Het
Slc17a2 A G 13: 23,814,986 I121V probably benign Het
Slc1a6 G A 10: 78,812,887 G481S probably damaging Het
Trav6-1 T C 14: 52,638,791 V56A possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r79 T A 7: 87,001,314 C103S probably benign Het
Wwp2 A T 8: 107,540,671 H305L probably damaging Het
Zfp593 A G 4: 134,244,913 V94A probably benign Het
Other mutations in Olfr1283
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02337:Olfr1283 APN 2 111369151 missense probably benign 0.22
IGL02716:Olfr1283 APN 2 111368781 missense probably benign 0.04
R0090:Olfr1283 UTSW 2 111369294 missense probably damaging 1.00
R0141:Olfr1283 UTSW 2 111369490 missense probably damaging 1.00
R0371:Olfr1283 UTSW 2 111369153 missense probably benign 0.00
R0417:Olfr1283 UTSW 2 111369105 missense possibly damaging 0.57
R1673:Olfr1283 UTSW 2 111369207 missense probably benign 0.11
R1970:Olfr1283 UTSW 2 111369076 missense probably benign 0.19
R2069:Olfr1283 UTSW 2 111369095 missense probably benign 0.43
R3897:Olfr1283 UTSW 2 111368761 missense possibly damaging 0.87
R4408:Olfr1283 UTSW 2 111369280 missense possibly damaging 0.63
R5397:Olfr1283 UTSW 2 111368940 missense probably benign 0.00
R5888:Olfr1283 UTSW 2 111368743 missense probably benign
R6281:Olfr1283 UTSW 2 111369549 makesense probably null
R6801:Olfr1283 UTSW 2 111369049 missense probably benign 0.22
R7219:Olfr1283 UTSW 2 111369537 missense probably benign
R7271:Olfr1283 UTSW 2 111369348 missense probably damaging 1.00
R7438:Olfr1283 UTSW 2 111369362 missense probably damaging 1.00
R7761:Olfr1283 UTSW 2 111368793 missense probably benign 0.00
R7792:Olfr1283 UTSW 2 111369403 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGATCTATTCCTGGGAATTTTGTGC -3'
(R):5'- AGAGGATCTGGCTCATGCAG -3'

Sequencing Primer
(F):5'- CATTCCCTGACTAGAAAAAGTATAGC -3'
(R):5'- CCCCCAAAGGAAATGGTTTTG -3'
Posted On2018-04-02