Mutagenetix > Incidental Mutations

Incidental Mutation 'R6323:Ano1'

510201

Institutional Source

Beutler Lab

Gene Symbol

Ano1

Ensembl Gene

ENSMUSG00000031075

Gene Name

anoctamin 1, calcium activated chloride channel

Synonyms

Tmem16a

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6323 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

144588549-144751974 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 144611686 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 601 (I601F)

Ref Sequence

ENSEMBL: ENSMUSP00000112616 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033393] [ENSMUST00000118556] [ENSMUST00000121758]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033393
AA Change: I540F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000033393
Gene: ENSMUSG00000031075
AA Change: I540F

Domain	Start	End	E-Value	Type
low complexity region	129	147	N/A	INTRINSIC
Pfam:Anoctamin	320	898	1.3e-149	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000118556
AA Change: I598F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000113899
Gene: ENSMUSG00000031075
AA Change: I598F

Domain	Start	End	E-Value	Type
Pfam:Anoct_dimer	112	375	5.5e-83	PFAM
Pfam:Anoctamin	378	955	6.7e-140	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121758
AA Change: I601F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000112616
Gene: ENSMUSG00000031075
AA Change: I601F

Domain	Start	End	E-Value	Type
Pfam:Anoct_dimer	54	317	7.1e-83	PFAM
Pfam:Anoctamin	320	901	2.2e-139	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131571

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208094

Meta Mutation Damage Score

0.2105

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

98% (40/41)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knockout allele exhibit postnatal death associated with aerophagia, slow postnatal weight gain, cyanosis, and abnormal tracheal morphology. Mice homozygous for a different knock-out allele exhibit proteinuria and intracellular endosomal vesicles in PTE cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	G	A	10: 82,283,082	T4698I	probably benign	Het
4933409G03Rik	A	G	2: 68,606,224	T171A	unknown	Het
Akr1c6	A	G	13: 4,447,018	K153R	possibly damaging	Het
Arfgef2	A	G	2: 166,834,484	Y8C	probably damaging	Het
Arhgef4	G	A	1: 34,723,477	A605T	unknown	Het
Atp1a2	C	G	1: 172,289,336	R238P	probably damaging	Het
Baz2a	A	G	10: 128,126,417	I1816V	probably benign	Het
Cadps2	T	A	6: 23,263,578	T1294S	probably benign	Het
Casz1	T	C	4: 148,941,704	S952P	possibly damaging	Het
Cdc20	T	C	4: 118,435,564	N329S	probably damaging	Het
Ceacam1	A	C	7: 25,474,651	L193R	probably damaging	Het
Celf5	A	G	10: 81,469,503	S143P	probably damaging	Het
Cfap74	A	G	4: 155,463,938	D1342G	possibly damaging	Het
Chd5	C	A	4: 152,367,334	T701K	probably damaging	Het
Cpt1b	C	A	15: 89,419,063	M596I	probably benign	Het
Ctrb1	A	G	8: 111,689,591	V21A	probably benign	Het
Diaph3	C	T	14: 86,966,453	V579I	probably benign	Het
Dlc1	T	C	8: 36,938,383	E84G	possibly damaging	Het
Dnajc14	A	G	10: 128,807,490	E427G	probably damaging	Het
Galns	T	C	8: 122,598,651	D254G	probably damaging	Het
Gpn3	C	T	5: 122,372,575		probably benign	Het
Gstm1	A	G	3: 108,017,747	V10A	probably benign	Het
Krt13	C	A	11: 100,121,150	A116S	probably damaging	Het
Lars2	A	T	9: 123,441,594	K584*	probably null	Het
Lrrc43	G	T	5: 123,503,886	G600W	probably damaging	Het
Madd	G	T	2: 91,161,438		probably null	Het
Mnat1	A	G	12: 73,168,104	D65G	probably damaging	Het
Nsmf	A	G	2: 25,055,051	N42S	possibly damaging	Het
Olfr1283	T	C	2: 111,368,701	L23P	possibly damaging	Het
Olfr198	A	G	16: 59,202,282	L48P	probably damaging	Het
Palld	A	T	8: 61,720,693	W311R	probably damaging	Het
Pax1	T	A	2: 147,368,401	V352E	probably damaging	Het
Rnf2	T	C	1: 151,473,216	K51R	probably damaging	Het
Rpl7l1	C	A	17: 46,782,638		probably benign	Het
Slc17a2	A	G	13: 23,814,986	I121V	probably benign	Het
Slc1a6	G	A	10: 78,812,887	G481S	probably damaging	Het
Trav6-1	T	C	14: 52,638,791	V56A	possibly damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r79	T	A	7: 87,001,314	C103S	probably benign	Het
Wwp2	A	T	8: 107,540,671	H305L	probably damaging	Het
Zfp593	A	G	4: 134,244,913	V94A	probably benign	Het

Other mutations in Ano1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00595:Ano1	APN	7	144638513	missense	probably damaging	1.00
IGL00754:Ano1	APN	7	144597231	missense	probably damaging	0.98
IGL00780:Ano1	APN	7	144655630	missense	probably damaging	0.99
IGL00918:Ano1	APN	7	144644752	splice site	probably benign
IGL01112:Ano1	APN	7	144637145	missense	possibly damaging	0.52
IGL01285:Ano1	APN	7	144644742	missense	probably benign	0.00
IGL01285:Ano1	APN	7	144595538	missense	probably damaging	0.98
IGL01308:Ano1	APN	7	144595498	missense	probably damaging	0.99
IGL01407:Ano1	APN	7	144637111	missense	probably benign	0.22
IGL01672:Ano1	APN	7	144655675	missense	probably damaging	0.96
IGL01920:Ano1	APN	7	144611454	splice site	probably benign
IGL01926:Ano1	APN	7	144610875	missense	possibly damaging	0.94
IGL02164:Ano1	APN	7	144637181	missense	possibly damaging	0.91
IGL02190:Ano1	APN	7	144618883	missense	probably benign	0.41
IGL02214:Ano1	APN	7	144655708	missense	possibly damaging	0.80
IGL02299:Ano1	APN	7	144590075	missense	possibly damaging	0.80
IGL02567:Ano1	APN	7	144611625	missense	probably damaging	1.00
IGL03131:Ano1	APN	7	144603585	missense	possibly damaging	0.90
IGL03291:Ano1	APN	7	144621675	missense	probably damaging	1.00
IGL03299:Ano1	APN	7	144654256	missense	probably damaging	1.00
IGL03394:Ano1	APN	7	144595439	splice site	probably null
PIT4434001:Ano1	UTSW	7	144610895	missense	probably benign	0.28
R0502:Ano1	UTSW	7	144597215	missense	probably damaging	1.00
R0595:Ano1	UTSW	7	144590153	missense	possibly damaging	0.94
R0732:Ano1	UTSW	7	144619488	critical splice acceptor site	probably null
R0970:Ano1	UTSW	7	144595571	missense	probably benign	0.02
R0988:Ano1	UTSW	7	144633653	missense	possibly damaging	0.94
R1074:Ano1	UTSW	7	144611680	missense	probably damaging	0.98
R1301:Ano1	UTSW	7	144633689	missense	possibly damaging	0.60
R1528:Ano1	UTSW	7	144595566	missense	probably damaging	1.00
R2018:Ano1	UTSW	7	144654250	missense	probably damaging	1.00
R2056:Ano1	UTSW	7	144648052	missense	probably damaging	1.00
R2057:Ano1	UTSW	7	144648052	missense	probably damaging	1.00
R2058:Ano1	UTSW	7	144648052	missense	probably damaging	1.00
R2059:Ano1	UTSW	7	144611390	missense	probably damaging	1.00
R2860:Ano1	UTSW	7	144590012	missense	probably damaging	1.00
R2861:Ano1	UTSW	7	144590012	missense	probably damaging	1.00
R3770:Ano1	UTSW	7	144595569	missense	probably damaging	1.00
R3970:Ano1	UTSW	7	144607963	missense	probably benign	0.00
R4179:Ano1	UTSW	7	144650505	missense	probably damaging	1.00
R4489:Ano1	UTSW	7	144611742	missense	probably benign	0.00
R4678:Ano1	UTSW	7	144669552	missense	probably benign	0.01
R4915:Ano1	UTSW	7	144611375	missense	possibly damaging	0.69
R5114:Ano1	UTSW	7	144657083	missense	possibly damaging	0.71
R5362:Ano1	UTSW	7	144648600	unclassified	probably benign
R5364:Ano1	UTSW	7	144637204	missense	probably damaging	1.00
R5366:Ano1	UTSW	7	144654209	missense	possibly damaging	0.85
R5387:Ano1	UTSW	7	144648619	missense	probably benign
R5762:Ano1	UTSW	7	144648037	missense	probably damaging	0.99
R5857:Ano1	UTSW	7	144637103	missense	probably benign	0.02
R6091:Ano1	UTSW	7	144669434	missense	probably benign	0.12
R6093:Ano1	UTSW	7	144611377	missense	possibly damaging	0.72
R6177:Ano1	UTSW	7	144678741	missense	possibly damaging	0.79
R6246:Ano1	UTSW	7	144633725	missense	possibly damaging	0.82
R6274:Ano1	UTSW	7	144618863	missense	probably benign	0.01
R6574:Ano1	UTSW	7	144607916	critical splice donor site	probably null
R6782:Ano1	UTSW	7	144621687	missense	probably damaging	1.00
R6880:Ano1	UTSW	7	144644742	missense	probably benign	0.00
R6909:Ano1	UTSW	7	144655731	missense	probably damaging	0.96
R7066:Ano1	UTSW	7	144637086	missense	probably benign	0.35
R7073:Ano1	UTSW	7	144638552	missense	probably damaging	0.96
R7146:Ano1	UTSW	7	144655656	missense	probably benign	0.00
R7420:Ano1	UTSW	7	144655641	missense	probably benign	0.00
R7874:Ano1	UTSW	7	144621724	missense	probably damaging	1.00
R8468:Ano1	UTSW	7	144655620	missense	probably damaging	1.00
R8867:Ano1	UTSW	7	144669660	missense	possibly damaging	0.66
R8923:Ano1	UTSW	7	144650551	missense	possibly damaging	0.61
R9215:Ano1	UTSW	7	144595605	missense	probably damaging	1.00
R9281:Ano1	UTSW	7	144595581	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACATACGGTACTGACTGTGC -3'
(R):5'- CCTAGCATTCCCACTAAGCATG -3'

Sequencing Primer
(F):5'- TACTGACTGTGCCAGCTGCTAG -3'
(R):5'- ACTAAGCATGTCTACGCCTG -3'

Posted On

2018-04-02