Mutagenetix > Incidental Mutation

Incidental Mutation 'R6323:Ano1'

510201

Institutional Source

Beutler Lab

Gene Symbol

Ano1

Ensembl Gene

ENSMUSG00000031075

Gene Name

anoctamin 1, calcium activated chloride channel

Synonyms

Tmem16a

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6323 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

144588549-144751974 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 144611686 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 601 (I601F)

Ref Sequence

ENSEMBL: ENSMUSP00000112616 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033393] [ENSMUST00000118556] [ENSMUST00000121758]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033393
AA Change: I540F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000033393
Gene: ENSMUSG00000031075
AA Change: I540F

Domain	Start	End	E-Value	Type
low complexity region	129	147	N/A	INTRINSIC
Pfam:Anoctamin	320	898	1.3e-149	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000118556
AA Change: I598F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000113899
Gene: ENSMUSG00000031075
AA Change: I598F

Domain	Start	End	E-Value	Type
Pfam:Anoct_dimer	112	375	5.5e-83	PFAM
Pfam:Anoctamin	378	955	6.7e-140	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121758
AA Change: I601F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000112616
Gene: ENSMUSG00000031075
AA Change: I601F

Domain	Start	End	E-Value	Type
Pfam:Anoct_dimer	54	317	7.1e-83	PFAM
Pfam:Anoctamin	320	901	2.2e-139	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131571

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208094

Meta Mutation Damage Score

0.2105

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

98% (40/41)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knockout allele exhibit postnatal death associated with aerophagia, slow postnatal weight gain, cyanosis, and abnormal tracheal morphology. Mice homozygous for a different knock-out allele exhibit proteinuria and intracellular endosomal vesicles in PTE cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	G	A	10: 82,283,082	T4698I	probably benign	Het
4933409G03Rik	A	G	2: 68,606,224	T171A	unknown	Het
Akr1c6	A	G	13: 4,447,018	K153R	possibly damaging	Het
Arfgef2	A	G	2: 166,834,484	Y8C	probably damaging	Het
Arhgef4	G	A	1: 34,723,477	A605T	unknown	Het
Atp1a2	C	G	1: 172,289,336	R238P	probably damaging	Het
Baz2a	A	G	10: 128,126,417	I1816V	probably benign	Het
Cadps2	T	A	6: 23,263,578	T1294S	probably benign	Het
Casz1	T	C	4: 148,941,704	S952P	possibly damaging	Het
Cdc20	T	C	4: 118,435,564	N329S	probably damaging	Het
Ceacam1	A	C	7: 25,474,651	L193R	probably damaging	Het
Celf5	A	G	10: 81,469,503	S143P	probably damaging	Het
Cfap74	A	G	4: 155,463,938	D1342G	possibly damaging	Het
Chd5	C	A	4: 152,367,334	T701K	probably damaging	Het
Cpt1b	C	A	15: 89,419,063	M596I	probably benign	Het
Ctrb1	A	G	8: 111,689,591	V21A	probably benign	Het
Diaph3	C	T	14: 86,966,453	V579I	probably benign	Het
Dlc1	T	C	8: 36,938,383	E84G	possibly damaging	Het
Dnajc14	A	G	10: 128,807,490	E427G	probably damaging	Het
Galns	T	C	8: 122,598,651	D254G	probably damaging	Het
Gpn3	C	T	5: 122,372,575		probably benign	Het
Gstm1	A	G	3: 108,017,747	V10A	probably benign	Het
Krt13	C	A	11: 100,121,150	A116S	probably damaging	Het
Lars2	A	T	9: 123,441,594	K584*	probably null	Het
Lrrc43	G	T	5: 123,503,886	G600W	probably damaging	Het
Madd	G	T	2: 91,161,438		probably null	Het
Mnat1	A	G	12: 73,168,104	D65G	probably damaging	Het
Nsmf	A	G	2: 25,055,051	N42S	possibly damaging	Het
Olfr1283	T	C	2: 111,368,701	L23P	possibly damaging	Het
Olfr198	A	G	16: 59,202,282	L48P	probably damaging	Het
Palld	A	T	8: 61,720,693	W311R	probably damaging	Het
Pax1	T	A	2: 147,368,401	V352E	probably damaging	Het
Rnf2	T	C	1: 151,473,216	K51R	probably damaging	Het
Rpl7l1	C	A	17: 46,782,638		probably benign	Het
Slc17a2	A	G	13: 23,814,986	I121V	probably benign	Het
Slc1a6	G	A	10: 78,812,887	G481S	probably damaging	Het
Trav6-1	T	C	14: 52,638,791	V56A	possibly damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r79	T	A	7: 87,001,314	C103S	probably benign	Het
Wwp2	A	T	8: 107,540,671	H305L	probably damaging	Het
Zfp593	A	G	4: 134,244,913	V94A	probably benign	Het

Other mutations in Ano1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00595:Ano1	APN	7	144638513	missense	probably damaging	1.00
IGL00754:Ano1	APN	7	144597231	missense	probably damaging	0.98
IGL00780:Ano1	APN	7	144655630	missense	probably damaging	0.99
IGL00918:Ano1	APN	7	144644752	splice site	probably benign
IGL01112:Ano1	APN	7	144637145	missense	possibly damaging	0.52
IGL01285:Ano1	APN	7	144644742	missense	probably benign	0.00
IGL01285:Ano1	APN	7	144595538	missense	probably damaging	0.98
IGL01308:Ano1	APN	7	144595498	missense	probably damaging	0.99
IGL01407:Ano1	APN	7	144637111	missense	probably benign	0.22
IGL01672:Ano1	APN	7	144655675	missense	probably damaging	0.96
IGL01920:Ano1	APN	7	144611454	splice site	probably benign
IGL01926:Ano1	APN	7	144610875	missense	possibly damaging	0.94
IGL02164:Ano1	APN	7	144637181	missense	possibly damaging	0.91
IGL02190:Ano1	APN	7	144618883	missense	probably benign	0.41
IGL02214:Ano1	APN	7	144655708	missense	possibly damaging	0.80
IGL02299:Ano1	APN	7	144590075	missense	possibly damaging	0.80
IGL02567:Ano1	APN	7	144611625	missense	probably damaging	1.00
IGL03131:Ano1	APN	7	144603585	missense	possibly damaging	0.90
IGL03291:Ano1	APN	7	144621675	missense	probably damaging	1.00
IGL03299:Ano1	APN	7	144654256	missense	probably damaging	1.00
IGL03394:Ano1	APN	7	144595439	splice site	probably null
PIT4434001:Ano1	UTSW	7	144610895	missense	probably benign	0.28
R0502:Ano1	UTSW	7	144597215	missense	probably damaging	1.00
R0595:Ano1	UTSW	7	144590153	missense	possibly damaging	0.94
R0732:Ano1	UTSW	7	144619488	critical splice acceptor site	probably null
R0970:Ano1	UTSW	7	144595571	missense	probably benign	0.02
R0988:Ano1	UTSW	7	144633653	missense	possibly damaging	0.94
R1074:Ano1	UTSW	7	144611680	missense	probably damaging	0.98
R1301:Ano1	UTSW	7	144633689	missense	possibly damaging	0.60
R1528:Ano1	UTSW	7	144595566	missense	probably damaging	1.00
R2018:Ano1	UTSW	7	144654250	missense	probably damaging	1.00
R2056:Ano1	UTSW	7	144648052	missense	probably damaging	1.00
R2057:Ano1	UTSW	7	144648052	missense	probably damaging	1.00
R2058:Ano1	UTSW	7	144648052	missense	probably damaging	1.00
R2059:Ano1	UTSW	7	144611390	missense	probably damaging	1.00
R2860:Ano1	UTSW	7	144590012	missense	probably damaging	1.00
R2861:Ano1	UTSW	7	144590012	missense	probably damaging	1.00
R3770:Ano1	UTSW	7	144595569	missense	probably damaging	1.00
R3970:Ano1	UTSW	7	144607963	missense	probably benign	0.00
R4179:Ano1	UTSW	7	144650505	missense	probably damaging	1.00
R4489:Ano1	UTSW	7	144611742	missense	probably benign	0.00
R4678:Ano1	UTSW	7	144669552	missense	probably benign	0.01
R4915:Ano1	UTSW	7	144611375	missense	possibly damaging	0.69
R5114:Ano1	UTSW	7	144657083	missense	possibly damaging	0.71
R5362:Ano1	UTSW	7	144648600	unclassified	probably benign
R5364:Ano1	UTSW	7	144637204	missense	probably damaging	1.00
R5366:Ano1	UTSW	7	144654209	missense	possibly damaging	0.85
R5387:Ano1	UTSW	7	144648619	missense	probably benign
R5762:Ano1	UTSW	7	144648037	missense	probably damaging	0.99
R5857:Ano1	UTSW	7	144637103	missense	probably benign	0.02
R6091:Ano1	UTSW	7	144669434	missense	probably benign	0.12
R6093:Ano1	UTSW	7	144611377	missense	possibly damaging	0.72
R6177:Ano1	UTSW	7	144678741	missense	possibly damaging	0.79
R6246:Ano1	UTSW	7	144633725	missense	possibly damaging	0.82
R6274:Ano1	UTSW	7	144618863	missense	probably benign	0.01
R6574:Ano1	UTSW	7	144607916	critical splice donor site	probably null
R6782:Ano1	UTSW	7	144621687	missense	probably damaging	1.00
R6880:Ano1	UTSW	7	144644742	missense	probably benign	0.00
R6909:Ano1	UTSW	7	144655731	missense	probably damaging	0.96
R7066:Ano1	UTSW	7	144637086	missense	probably benign	0.35
R7073:Ano1	UTSW	7	144638552	missense	probably damaging	0.96
R7146:Ano1	UTSW	7	144655656	missense	probably benign	0.00
R7420:Ano1	UTSW	7	144655641	missense	probably benign	0.00
R7874:Ano1	UTSW	7	144621724	missense	probably damaging	1.00
R8468:Ano1	UTSW	7	144655620	missense	probably damaging	1.00
R8867:Ano1	UTSW	7	144669660	missense	possibly damaging	0.66
R8923:Ano1	UTSW	7	144650551	missense	possibly damaging	0.61
R9215:Ano1	UTSW	7	144595605	missense	probably damaging	1.00
R9281:Ano1	UTSW	7	144595581	missense	probably damaging	1.00
R9572:Ano1	UTSW	7	144650556	critical splice acceptor site	probably null
R9668:Ano1	UTSW	7	144610842	critical splice donor site	probably null
R9681:Ano1	UTSW	7	144590156	missense	possibly damaging	0.68
R9756:Ano1	UTSW	7	144608929	missense	probably benign	0.45
R9780:Ano1	UTSW	7	144655621	missense	probably damaging	1.00
R9792:Ano1	UTSW	7	144621697	missense	probably damaging	1.00
R9793:Ano1	UTSW	7	144621697	missense	probably damaging	1.00
R9795:Ano1	UTSW	7	144621697	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACATACGGTACTGACTGTGC -3'
(R):5'- CCTAGCATTCCCACTAAGCATG -3'

Sequencing Primer
(F):5'- TACTGACTGTGCCAGCTGCTAG -3'
(R):5'- ACTAAGCATGTCTACGCCTG -3'

Posted On

2018-04-02