Mutagenetix > Incidental Mutation

Incidental Mutation 'R6323:Lars2'

510207

Institutional Source

Beutler Lab

Gene Symbol

Lars2

Ensembl Gene

ENSMUSG00000035202

Gene Name

leucyl-tRNA synthetase, mitochondrial

Synonyms

Kiaa0028

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6323 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123366927-123462666 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 123441594 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 584 (K584*)

Ref Sequence

ENSEMBL: ENSMUSP00000036710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038863] [ENSMUST00000217116]

AlphaFold

Q8VDC0

Predicted Effect

probably null
Transcript: ENSMUST00000038863
AA Change: K584*

SMART Domains

Protein: ENSMUSP00000036710
Gene: ENSMUSG00000035202
AA Change: K584*

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	57	223	7.6e-24	PFAM
Pfam:tRNA-synt_1g	83	239	9.3e-20	PFAM
Pfam:tRNA-synt_1_2	269	430	1.1e-8	PFAM
Pfam:tRNA-synt_1	434	609	5.6e-8	PFAM
Pfam:tRNA-synt_1g	589	682	1.2e-6	PFAM
Pfam:tRNA-synt_1	633	678	1.6e-7	PFAM
Pfam:Anticodon_1	724	867	9.2e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217116

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class 1 aminoacyl-tRNA synthetase, mitochondrial leucyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	G	A	10: 82,283,082	T4698I	probably benign	Het
4933409G03Rik	A	G	2: 68,606,224	T171A	unknown	Het
Akr1c6	A	G	13: 4,447,018	K153R	possibly damaging	Het
Ano1	T	A	7: 144,611,686	I601F	possibly damaging	Het
Arfgef2	A	G	2: 166,834,484	Y8C	probably damaging	Het
Arhgef4	G	A	1: 34,723,477	A605T	unknown	Het
Atp1a2	C	G	1: 172,289,336	R238P	probably damaging	Het
Baz2a	A	G	10: 128,126,417	I1816V	probably benign	Het
Cadps2	T	A	6: 23,263,578	T1294S	probably benign	Het
Casz1	T	C	4: 148,941,704	S952P	possibly damaging	Het
Cdc20	T	C	4: 118,435,564	N329S	probably damaging	Het
Ceacam1	A	C	7: 25,474,651	L193R	probably damaging	Het
Celf5	A	G	10: 81,469,503	S143P	probably damaging	Het
Cfap74	A	G	4: 155,463,938	D1342G	possibly damaging	Het
Chd5	C	A	4: 152,367,334	T701K	probably damaging	Het
Cpt1b	C	A	15: 89,419,063	M596I	probably benign	Het
Ctrb1	A	G	8: 111,689,591	V21A	probably benign	Het
Diaph3	C	T	14: 86,966,453	V579I	probably benign	Het
Dlc1	T	C	8: 36,938,383	E84G	possibly damaging	Het
Dnajc14	A	G	10: 128,807,490	E427G	probably damaging	Het
Galns	T	C	8: 122,598,651	D254G	probably damaging	Het
Gpn3	C	T	5: 122,372,575		probably benign	Het
Gstm1	A	G	3: 108,017,747	V10A	probably benign	Het
Krt13	C	A	11: 100,121,150	A116S	probably damaging	Het
Lrrc43	G	T	5: 123,503,886	G600W	probably damaging	Het
Madd	G	T	2: 91,161,438		probably null	Het
Mnat1	A	G	12: 73,168,104	D65G	probably damaging	Het
Nsmf	A	G	2: 25,055,051	N42S	possibly damaging	Het
Olfr1283	T	C	2: 111,368,701	L23P	possibly damaging	Het
Olfr198	A	G	16: 59,202,282	L48P	probably damaging	Het
Palld	A	T	8: 61,720,693	W311R	probably damaging	Het
Pax1	T	A	2: 147,368,401	V352E	probably damaging	Het
Rnf2	T	C	1: 151,473,216	K51R	probably damaging	Het
Rpl7l1	C	A	17: 46,782,638		probably benign	Het
Slc17a2	A	G	13: 23,814,986	I121V	probably benign	Het
Slc1a6	G	A	10: 78,812,887	G481S	probably damaging	Het
Trav6-1	T	C	14: 52,638,791	V56A	possibly damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r79	T	A	7: 87,001,314	C103S	probably benign	Het
Wwp2	A	T	8: 107,540,671	H305L	probably damaging	Het
Zfp593	A	G	4: 134,244,913	V94A	probably benign	Het

Other mutations in Lars2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01743:Lars2	APN	9	123453248	missense	probably damaging	0.98
IGL01993:Lars2	APN	9	123394943	splice site	probably benign
IGL02155:Lars2	APN	9	123454982	missense	probably damaging	0.99
IGL02941:Lars2	APN	9	123459585	missense	probably damaging	0.97
IGL03090:Lars2	APN	9	123455960	missense	probably damaging	1.00
IGL03271:Lars2	APN	9	123459484	splice site	probably null
IGL03386:Lars2	APN	9	123453390	nonsense	probably null
IGL03410:Lars2	APN	9	123418776	missense	possibly damaging	0.87
ulrich	UTSW	9	123418693	missense	probably damaging	0.99
K3955:Lars2	UTSW	9	123377777	missense	probably damaging	1.00
P0038:Lars2	UTSW	9	123377777	missense	probably damaging	1.00
R0276:Lars2	UTSW	9	123438121	splice site	probably benign
R1671:Lars2	UTSW	9	123418279	missense	probably benign	0.02
R1829:Lars2	UTSW	9	123431917	missense	probably benign	0.00
R2219:Lars2	UTSW	9	123418780	missense	probably damaging	0.98
R2220:Lars2	UTSW	9	123418780	missense	probably damaging	0.98
R4610:Lars2	UTSW	9	123418693	missense	probably damaging	0.99
R5027:Lars2	UTSW	9	123441495	missense	probably benign	0.38
R5195:Lars2	UTSW	9	123453310	missense	probably damaging	0.97
R5597:Lars2	UTSW	9	123454982	missense	probably damaging	0.99
R5756:Lars2	UTSW	9	123438199	missense	probably damaging	1.00
R5783:Lars2	UTSW	9	123461596	missense	probably benign
R6045:Lars2	UTSW	9	123371988	missense	probably damaging	1.00
R6235:Lars2	UTSW	9	123411880	missense	probably damaging	1.00
R6377:Lars2	UTSW	9	123454760	missense	probably benign	0.00
R6395:Lars2	UTSW	9	123371925	missense	probably benign	0.06
R7094:Lars2	UTSW	9	123459585	missense	probably damaging	0.99
R7144:Lars2	UTSW	9	123431993	missense	probably damaging	1.00
R7233:Lars2	UTSW	9	123411954	nonsense	probably null
R7254:Lars2	UTSW	9	123454963	missense	possibly damaging	0.93
R7350:Lars2	UTSW	9	123427480	missense	probably damaging	1.00
R7413:Lars2	UTSW	9	123459503	missense	probably benign	0.30
R7614:Lars2	UTSW	9	123395111	missense
R7683:Lars2	UTSW	9	123377830	critical splice donor site	probably null
R8000:Lars2	UTSW	9	123436244	missense	probably damaging	1.00
R8061:Lars2	UTSW	9	123459497	missense	probably benign
R8355:Lars2	UTSW	9	123454715	missense	probably damaging	1.00
R8364:Lars2	UTSW	9	123411954	nonsense	probably null
R8818:Lars2	UTSW	9	123392827	missense	possibly damaging	0.94
R9007:Lars2	UTSW	9	123431915	nonsense	probably null
R9351:Lars2	UTSW	9	123436301	missense	probably benign	0.38
Z1177:Lars2	UTSW	9	123454782	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGGCACTAGTATTTTCAAGGGATG -3'
(R):5'- AGAGGTTTGTGTAAATGGACCTC -3'

Sequencing Primer
(F):5'- TTTTCAAGGGATGAGCACACATAGC -3'
(R):5'- TGGACCTCAAATTGTAAAGACCTAC -3'

Posted On

2018-04-02