Incidental Mutation 'R6323:Krt13'
ID510213
Institutional Source Beutler Lab
Gene Symbol Krt13
Ensembl Gene ENSMUSG00000044041
Gene Namekeratin 13
SynonymsK13, Krt-1.13, Krt1-13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R6323 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location100117327-100121566 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 100121150 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 116 (A116S)
Ref Sequence ENSEMBL: ENSMUSP00000007275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007275]
Predicted Effect probably damaging
Transcript: ENSMUST00000007275
AA Change: A116S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000007275
Gene: ENSMUSG00000044041
AA Change: A116S

DomainStartEndE-ValueType
internal_repeat_1 5 21 1.02e-5 PROSPERO
internal_repeat_1 16 32 1.02e-5 PROSPERO
low complexity region 39 94 N/A INTRINSIC
Filament 95 407 7.21e-169 SMART
low complexity region 409 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134282
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,283,082 T4698I probably benign Het
4933409G03Rik A G 2: 68,606,224 T171A unknown Het
Akr1c6 A G 13: 4,447,018 K153R possibly damaging Het
Ano1 T A 7: 144,611,686 I601F possibly damaging Het
Arfgef2 A G 2: 166,834,484 Y8C probably damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2a A G 10: 128,126,417 I1816V probably benign Het
Cadps2 T A 6: 23,263,578 T1294S probably benign Het
Casz1 T C 4: 148,941,704 S952P possibly damaging Het
Cdc20 T C 4: 118,435,564 N329S probably damaging Het
Ceacam1 A C 7: 25,474,651 L193R probably damaging Het
Celf5 A G 10: 81,469,503 S143P probably damaging Het
Cfap74 A G 4: 155,463,938 D1342G possibly damaging Het
Chd5 C A 4: 152,367,334 T701K probably damaging Het
Cpt1b C A 15: 89,419,063 M596I probably benign Het
Ctrb1 A G 8: 111,689,591 V21A probably benign Het
Diaph3 C T 14: 86,966,453 V579I probably benign Het
Dlc1 T C 8: 36,938,383 E84G possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Galns T C 8: 122,598,651 D254G probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gstm1 A G 3: 108,017,747 V10A probably benign Het
Lars2 A T 9: 123,441,594 K584* probably null Het
Lrrc43 G T 5: 123,503,886 G600W probably damaging Het
Madd G T 2: 91,161,438 probably null Het
Mnat1 A G 12: 73,168,104 D65G probably damaging Het
Nsmf A G 2: 25,055,051 N42S possibly damaging Het
Olfr1283 T C 2: 111,368,701 L23P possibly damaging Het
Olfr198 A G 16: 59,202,282 L48P probably damaging Het
Palld A T 8: 61,720,693 W311R probably damaging Het
Pax1 T A 2: 147,368,401 V352E probably damaging Het
Rnf2 T C 1: 151,473,216 K51R probably damaging Het
Rpl7l1 C A 17: 46,782,638 probably benign Het
Slc17a2 A G 13: 23,814,986 I121V probably benign Het
Slc1a6 G A 10: 78,812,887 G481S probably damaging Het
Trav6-1 T C 14: 52,638,791 V56A possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r79 T A 7: 87,001,314 C103S probably benign Het
Wwp2 A T 8: 107,540,671 H305L probably damaging Het
Zfp593 A G 4: 134,244,913 V94A probably benign Het
Other mutations in Krt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Krt13 APN 11 100119713 missense probably damaging 1.00
IGL02532:Krt13 APN 11 100119369 missense probably damaging 1.00
IGL02934:Krt13 APN 11 100119084 missense probably damaging 0.99
PIT4651001:Krt13 UTSW 11 100120036 missense probably damaging 0.98
R0092:Krt13 UTSW 11 100121432 nonsense probably null
R0722:Krt13 UTSW 11 100119153 missense probably damaging 1.00
R1228:Krt13 UTSW 11 100121477 missense probably benign 0.18
R1400:Krt13 UTSW 11 100121284 missense probably damaging 1.00
R1751:Krt13 UTSW 11 100121100 missense possibly damaging 0.84
R1767:Krt13 UTSW 11 100121100 missense possibly damaging 0.84
R2420:Krt13 UTSW 11 100120051 missense probably benign 0.43
R2421:Krt13 UTSW 11 100120051 missense probably benign 0.43
R2869:Krt13 UTSW 11 100117649 missense unknown
R2869:Krt13 UTSW 11 100117649 missense unknown
R4421:Krt13 UTSW 11 100118935 missense possibly damaging 0.94
R4451:Krt13 UTSW 11 100118001 missense unknown
R4520:Krt13 UTSW 11 100119348 missense probably damaging 0.99
R4632:Krt13 UTSW 11 100121224 missense possibly damaging 0.96
R4656:Krt13 UTSW 11 100119363 missense probably damaging 1.00
R4872:Krt13 UTSW 11 100121506 start gained probably benign
R5709:Krt13 UTSW 11 100117643 missense unknown
R6014:Krt13 UTSW 11 100117611 missense unknown
R6391:Krt13 UTSW 11 100119376 missense probably damaging 0.96
R7535:Krt13 UTSW 11 100117998 missense unknown
R7562:Krt13 UTSW 11 100119336 missense probably damaging 1.00
R7867:Krt13 UTSW 11 100121182 missense probably damaging 1.00
R7950:Krt13 UTSW 11 100121182 missense probably damaging 1.00
X0013:Krt13 UTSW 11 100119348 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCCTGTCCTGAGGAAAAC -3'
(R):5'- TTTGTCACTGGAGGGTCAGC -3'

Sequencing Primer
(F):5'- CTGTCCTGAGGAAAACTTCTTAGC -3'
(R):5'- CACTGGAGGGTCAGCTGGAG -3'
Posted On2018-04-02