Incidental Mutation 'R6323:Akr1c6'
ID510215
Institutional Source Beutler Lab
Gene Symbol Akr1c6
Ensembl Gene ENSMUSG00000021210
Gene Namealdo-keto reductase family 1, member C6
Synonyms3alpha-HSD, estradiol 17-beta-dehydrogenase (A-specific), Hsd17b5, Akr1c1
MMRRC Submission
Accession Numbers

Genbank: NM_030611; MGI: 1933427

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6323 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location4434306-4457877 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4447018 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 153 (K153R)
Ref Sequence ENSEMBL: ENSMUSP00000021630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021630] [ENSMUST00000156277] [ENSMUST00000220941] [ENSMUST00000223118]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021630
AA Change: K153R

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021630
Gene: ENSMUSG00000021210
AA Change: K153R

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 301 2.2e-58 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000156277
AA Change: K100R

PolyPhen 2 Score 0.713 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117624
Gene: ENSMUSG00000021210
AA Change: K100R

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 1 173 3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220941
Predicted Effect probably benign
Transcript: ENSMUST00000223118
Meta Mutation Damage Score 0.0711 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols by utilizing NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme catalyzes the bioreduction of chlordecone, a toxic organochlorine pesticide, to chlordecone alcohol in liver. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,283,082 T4698I probably benign Het
4933409G03Rik A G 2: 68,606,224 T171A unknown Het
Ano1 T A 7: 144,611,686 I601F possibly damaging Het
Arfgef2 A G 2: 166,834,484 Y8C probably damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2a A G 10: 128,126,417 I1816V probably benign Het
Cadps2 T A 6: 23,263,578 T1294S probably benign Het
Casz1 T C 4: 148,941,704 S952P possibly damaging Het
Cdc20 T C 4: 118,435,564 N329S probably damaging Het
Ceacam1 A C 7: 25,474,651 L193R probably damaging Het
Celf5 A G 10: 81,469,503 S143P probably damaging Het
Cfap74 A G 4: 155,463,938 D1342G possibly damaging Het
Chd5 C A 4: 152,367,334 T701K probably damaging Het
Cpt1b C A 15: 89,419,063 M596I probably benign Het
Ctrb1 A G 8: 111,689,591 V21A probably benign Het
Diaph3 C T 14: 86,966,453 V579I probably benign Het
Dlc1 T C 8: 36,938,383 E84G possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Galns T C 8: 122,598,651 D254G probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gstm1 A G 3: 108,017,747 V10A probably benign Het
Krt13 C A 11: 100,121,150 A116S probably damaging Het
Lars2 A T 9: 123,441,594 K584* probably null Het
Lrrc43 G T 5: 123,503,886 G600W probably damaging Het
Madd G T 2: 91,161,438 probably null Het
Mnat1 A G 12: 73,168,104 D65G probably damaging Het
Nsmf A G 2: 25,055,051 N42S possibly damaging Het
Olfr1283 T C 2: 111,368,701 L23P possibly damaging Het
Olfr198 A G 16: 59,202,282 L48P probably damaging Het
Palld A T 8: 61,720,693 W311R probably damaging Het
Pax1 T A 2: 147,368,401 V352E probably damaging Het
Rnf2 T C 1: 151,473,216 K51R probably damaging Het
Rpl7l1 C A 17: 46,782,638 probably benign Het
Slc17a2 A G 13: 23,814,986 I121V probably benign Het
Slc1a6 G A 10: 78,812,887 G481S probably damaging Het
Trav6-1 T C 14: 52,638,791 V56A possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r79 T A 7: 87,001,314 C103S probably benign Het
Wwp2 A T 8: 107,540,671 H305L probably damaging Het
Zfp593 A G 4: 134,244,913 V94A probably benign Het
Other mutations in Akr1c6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Akr1c6 APN 13 4448978 splice site probably benign
IGL01838:Akr1c6 APN 13 4449036 missense probably benign 0.44
IGL02318:Akr1c6 APN 13 4438497 missense probably benign 0.05
IGL02986:Akr1c6 APN 13 4436415 missense probably benign 0.42
IGL03168:Akr1c6 APN 13 4436281 missense probably benign 0.04
IGL03190:Akr1c6 APN 13 4446413 missense possibly damaging 0.49
IGL03258:Akr1c6 APN 13 4436409 missense probably damaging 1.00
R0940:Akr1c6 UTSW 13 4436373 missense probably benign 0.42
R1442:Akr1c6 UTSW 13 4457160 missense probably damaging 1.00
R1624:Akr1c6 UTSW 13 4446364 missense probably benign
R1937:Akr1c6 UTSW 13 4446384 missense probably benign 0.01
R2392:Akr1c6 UTSW 13 4434478 splice site probably null
R2398:Akr1c6 UTSW 13 4449036 missense probably benign 0.44
R4655:Akr1c6 UTSW 13 4449429 missense probably damaging 0.98
R4761:Akr1c6 UTSW 13 4447011 missense probably benign 0.01
R4913:Akr1c6 UTSW 13 4454525 missense probably benign 0.18
R4923:Akr1c6 UTSW 13 4454495 missense probably damaging 1.00
R4953:Akr1c6 UTSW 13 4438609 splice site probably null
R5255:Akr1c6 UTSW 13 4447019 missense probably benign 0.20
R5452:Akr1c6 UTSW 13 4454545 missense probably benign 0.00
R5660:Akr1c6 UTSW 13 4449054 missense probably benign 0.13
R6242:Akr1c6 UTSW 13 4436362 missense probably benign 0.01
R6599:Akr1c6 UTSW 13 4449319 unclassified probably null
R6847:Akr1c6 UTSW 13 4438498 nonsense probably null
R6989:Akr1c6 UTSW 13 4449046 missense probably damaging 1.00
R7003:Akr1c6 UTSW 13 4454515 missense probably benign 0.14
R7251:Akr1c6 UTSW 13 4447020 missense probably damaging 1.00
R7310:Akr1c6 UTSW 13 4436355 missense probably benign
X0062:Akr1c6 UTSW 13 4438535 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCGCTCAGGGTCATCTTAATAATCG -3'
(R):5'- TTGGCATCTGTCAGCTGCAG -3'

Sequencing Primer
(F):5'- ATCTGCATGGAGATGTTAGATCCC -3'
(R):5'- CATCTGTCAGCTGCAGAGGAAG -3'
Posted On2018-04-02