Incidental Mutation 'R6323:Slc34a1'
ID 510216
Institutional Source Beutler Lab
Gene Symbol Slc34a1
Ensembl Gene ENSMUSG00000021490
Gene Name solute carrier family 34 (sodium phosphate), member 1
Synonyms Slc17a2, Npt2, Na/Pi cotransporter, renal Na+/Pi transporter, NaPi-IIa
MMRRC Submission 044477-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R6323 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 55547435-55562508 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23998969 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 121 (I121V)
Ref Sequence ENSEMBL: ENSMUSP00000097288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006786] [ENSMUST00000099697]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006786
AA Change: I121V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000006786
Gene: ENSMUSG00000036110
AA Change: I121V

DomainStartEndE-ValueType
Pfam:MFS_1 19 425 3.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099697
AA Change: I121V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097288
Gene: ENSMUSG00000036110
AA Change: I121V

DomainStartEndE-ValueType
Pfam:MFS_1 19 425 2.9e-45 PFAM
transmembrane domain 443 462 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141717
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II sodium-phosphate cotransporter family. Mutations in this gene are associated with hypophosphatemia nephrolithiasis/osteoporosis 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice exhibit renal phosphate wasting, hyerpcalciuria, and skeletal abnormalities. Postnatal viability is reduced, putatively due to poor nutritional status. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,436,568 (GRCm39) T171A unknown Het
Akr1c6 A G 13: 4,497,017 (GRCm39) K153R possibly damaging Het
Ano1 T A 7: 144,165,423 (GRCm39) I601F possibly damaging Het
Arfgef2 A G 2: 166,676,404 (GRCm39) Y8C probably damaging Het
Arhgef4 G A 1: 34,762,558 (GRCm39) A605T unknown Het
Atp1a2 C G 1: 172,116,903 (GRCm39) R238P probably damaging Het
Baz2a A G 10: 127,962,286 (GRCm39) I1816V probably benign Het
Cadps2 T A 6: 23,263,577 (GRCm39) T1294S probably benign Het
Casz1 T C 4: 149,026,161 (GRCm39) S952P possibly damaging Het
Cdc20 T C 4: 118,292,761 (GRCm39) N329S probably damaging Het
Ceacam1 A C 7: 25,174,076 (GRCm39) L193R probably damaging Het
Celf5 A G 10: 81,305,337 (GRCm39) S143P probably damaging Het
Cfap74 A G 4: 155,548,395 (GRCm39) D1342G possibly damaging Het
Chd5 C A 4: 152,451,791 (GRCm39) T701K probably damaging Het
Cpt1b C A 15: 89,303,266 (GRCm39) M596I probably benign Het
Ctrb1 A G 8: 112,416,223 (GRCm39) V21A probably benign Het
Diaph3 C T 14: 87,203,889 (GRCm39) V579I probably benign Het
Dlc1 T C 8: 37,405,537 (GRCm39) E84G possibly damaging Het
Dnajc14 A G 10: 128,643,359 (GRCm39) E427G probably damaging Het
Galns T C 8: 123,325,390 (GRCm39) D254G probably damaging Het
Gpn3 C T 5: 122,510,638 (GRCm39) probably benign Het
Gstm1 A G 3: 107,925,063 (GRCm39) V10A probably benign Het
Krt13 C A 11: 100,011,976 (GRCm39) A116S probably damaging Het
Lars2 A T 9: 123,270,659 (GRCm39) K584* probably null Het
Lrrc43 G T 5: 123,641,949 (GRCm39) G600W probably damaging Het
Madd G T 2: 90,991,783 (GRCm39) probably null Het
Mnat1 A G 12: 73,214,878 (GRCm39) D65G probably damaging Het
Nsmf A G 2: 24,945,063 (GRCm39) N42S possibly damaging Het
Or4k77 T C 2: 111,199,046 (GRCm39) L23P possibly damaging Het
Or5ac16 A G 16: 59,022,645 (GRCm39) L48P probably damaging Het
Palld A T 8: 62,173,727 (GRCm39) W311R probably damaging Het
Pax1 T A 2: 147,210,321 (GRCm39) V352E probably damaging Het
Rnf2 T C 1: 151,348,967 (GRCm39) K51R probably damaging Het
Rpl7l1 C A 17: 47,093,564 (GRCm39) probably benign Het
Slc1a6 G A 10: 78,648,721 (GRCm39) G481S probably damaging Het
Spata31h1 G A 10: 82,118,916 (GRCm39) T4698I probably benign Het
Trav6-1 T C 14: 52,876,248 (GRCm39) V56A possibly damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Vmn2r79 T A 7: 86,650,522 (GRCm39) C103S probably benign Het
Wwp2 A T 8: 108,267,303 (GRCm39) H305L probably damaging Het
Zfp593 A G 4: 133,972,224 (GRCm39) V94A probably benign Het
Other mutations in Slc34a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Slc34a1 APN 13 24,003,317 (GRCm39) missense probably benign 0.13
IGL01120:Slc34a1 APN 13 55,556,884 (GRCm39) missense probably damaging 1.00
IGL01396:Slc34a1 APN 13 55,550,546 (GRCm39) missense probably damaging 1.00
IGL01405:Slc34a1 APN 13 55,559,941 (GRCm39) missense probably damaging 1.00
IGL01511:Slc34a1 APN 13 24,003,121 (GRCm39) critical splice donor site probably null
IGL01624:Slc34a1 APN 13 23,998,969 (GRCm39) missense probably benign 0.00
IGL01839:Slc34a1 APN 13 23,996,668 (GRCm39) missense possibly damaging 0.91
IGL02010:Slc34a1 APN 13 24,003,025 (GRCm39) missense probably benign 0.00
IGL02525:Slc34a1 APN 13 55,551,051 (GRCm39) splice site probably benign
IGL02555:Slc34a1 APN 13 55,548,981 (GRCm39) missense possibly damaging 0.77
IGL02692:Slc34a1 APN 13 55,551,049 (GRCm39) splice site probably benign
IGL03173:Slc34a1 APN 13 55,561,089 (GRCm39) missense probably damaging 0.99
IGL03221:Slc34a1 APN 13 55,548,591 (GRCm39) missense probably benign 0.00
IGL03299:Slc34a1 APN 13 24,005,094 (GRCm39) critical splice donor site probably null
Rockies UTSW 13 24,003,317 (GRCm39) missense probably damaging 0.99
R0190:Slc34a1 UTSW 13 55,556,914 (GRCm39) missense probably benign 0.00
R0196:Slc34a1 UTSW 13 55,560,078 (GRCm39) missense probably damaging 0.99
R0362:Slc34a1 UTSW 13 55,550,711 (GRCm39) splice site probably null
R0622:Slc34a1 UTSW 13 23,996,594 (GRCm39) missense probably damaging 1.00
R1055:Slc34a1 UTSW 13 55,550,846 (GRCm39) missense probably benign 0.26
R1104:Slc34a1 UTSW 13 24,003,920 (GRCm39) missense probably damaging 0.99
R1243:Slc34a1 UTSW 13 55,559,944 (GRCm39) missense possibly damaging 0.85
R1414:Slc34a1 UTSW 13 55,548,524 (GRCm39) missense probably benign
R1530:Slc34a1 UTSW 13 24,003,052 (GRCm39) missense probably damaging 1.00
R1566:Slc34a1 UTSW 13 55,559,844 (GRCm39) critical splice acceptor site probably null
R1682:Slc34a1 UTSW 13 23,996,623 (GRCm39) missense probably damaging 0.96
R1732:Slc34a1 UTSW 13 55,561,233 (GRCm39) missense probably benign
R1901:Slc34a1 UTSW 13 55,548,963 (GRCm39) nonsense probably null
R2255:Slc34a1 UTSW 13 24,004,991 (GRCm39) missense probably benign 0.09
R2423:Slc34a1 UTSW 13 55,556,865 (GRCm39) missense possibly damaging 0.63
R2986:Slc34a1 UTSW 13 55,551,142 (GRCm39) missense probably benign 0.00
R3940:Slc34a1 UTSW 13 55,560,983 (GRCm39) missense probably damaging 1.00
R4003:Slc34a1 UTSW 13 55,550,474 (GRCm39) splice site probably benign
R4553:Slc34a1 UTSW 13 55,559,874 (GRCm39) splice site probably null
R4735:Slc34a1 UTSW 13 55,561,397 (GRCm39) missense probably benign 0.13
R4923:Slc34a1 UTSW 13 24,003,078 (GRCm39) missense probably benign 0.20
R5177:Slc34a1 UTSW 13 55,548,975 (GRCm39) missense probably damaging 0.99
R5193:Slc34a1 UTSW 13 24,003,845 (GRCm39) critical splice acceptor site probably null
R5321:Slc34a1 UTSW 13 23,996,614 (GRCm39) missense possibly damaging 0.95
R5334:Slc34a1 UTSW 13 24,003,034 (GRCm39) missense probably damaging 0.97
R5345:Slc34a1 UTSW 13 55,548,331 (GRCm39) missense probably benign
R5363:Slc34a1 UTSW 13 55,560,103 (GRCm39) missense probably damaging 1.00
R5363:Slc34a1 UTSW 13 55,551,081 (GRCm39) missense probably benign 0.16
R5377:Slc34a1 UTSW 13 23,996,575 (GRCm39) missense probably damaging 1.00
R5668:Slc34a1 UTSW 13 55,556,898 (GRCm39) missense possibly damaging 0.94
R5685:Slc34a1 UTSW 13 55,549,085 (GRCm39) critical splice donor site probably null
R5782:Slc34a1 UTSW 13 55,550,501 (GRCm39) missense possibly damaging 0.92
R5836:Slc34a1 UTSW 13 55,561,278 (GRCm39) missense probably benign 0.05
R6047:Slc34a1 UTSW 13 55,559,884 (GRCm39) missense probably damaging 1.00
R6165:Slc34a1 UTSW 13 23,999,053 (GRCm39) missense probably benign 0.00
R6280:Slc34a1 UTSW 13 24,006,377 (GRCm39) missense probably benign
R6311:Slc34a1 UTSW 13 23,999,005 (GRCm39) missense probably benign 0.40
R6476:Slc34a1 UTSW 13 23,996,569 (GRCm39) missense probably damaging 1.00
R6496:Slc34a1 UTSW 13 55,550,495 (GRCm39) missense probably benign 0.15
R6814:Slc34a1 UTSW 13 24,006,372 (GRCm39) missense possibly damaging 0.55
R7155:Slc34a1 UTSW 13 24,006,390 (GRCm39) missense probably benign 0.21
R7158:Slc34a1 UTSW 13 55,549,044 (GRCm39) missense probably damaging 0.99
R7188:Slc34a1 UTSW 13 24,006,348 (GRCm39) missense probably damaging 1.00
R7288:Slc34a1 UTSW 13 24,003,095 (GRCm39) missense probably benign 0.09
R7384:Slc34a1 UTSW 13 55,550,747 (GRCm39) missense probably benign 0.00
R7462:Slc34a1 UTSW 13 24,006,401 (GRCm39) missense probably damaging 1.00
R7694:Slc34a1 UTSW 13 55,561,221 (GRCm39) missense probably benign 0.22
R7808:Slc34a1 UTSW 13 24,003,317 (GRCm39) missense probably damaging 0.99
R7937:Slc34a1 UTSW 13 23,996,648 (GRCm39) missense probably benign
R8444:Slc34a1 UTSW 13 24,003,061 (GRCm39) missense probably benign 0.00
R8447:Slc34a1 UTSW 13 24,006,309 (GRCm39) missense possibly damaging 0.50
R8932:Slc34a1 UTSW 13 24,004,184 (GRCm39) missense probably benign 0.00
R8977:Slc34a1 UTSW 13 55,556,815 (GRCm39) missense probably benign 0.01
R9635:Slc34a1 UTSW 13 55,556,940 (GRCm39) missense probably damaging 1.00
X0022:Slc34a1 UTSW 13 55,550,828 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTTAGCAAAGAGGGTGCCC -3'
(R):5'- TGTGAACTGACCAGTCCAGG -3'

Sequencing Primer
(F):5'- GGGTGCCCCTACTAACTAAGAAC -3'
(R):5'- GGCCATTCCCTGCAATGAAAGTG -3'
Posted On 2018-04-02