Mutagenetix > Incidental Mutation

Incidental Mutation 'R6325:Gpd2'

510225

Institutional Source

Beutler Lab

Gene Symbol

Gpd2

Ensembl Gene

ENSMUSG00000026827

Gene Name

glycerol phosphate dehydrogenase 2, mitochondrial

Synonyms

Gdm1

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.697) question?

Stock #

R6325 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57237635-57370719 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 57304396 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 104 (S104P)

Ref Sequence

ENSEMBL: ENSMUSP00000130992 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028167] [ENSMUST00000112618] [ENSMUST00000169687]

AlphaFold

Q64521

Predicted Effect

probably damaging
Transcript: ENSMUST00000028167
AA Change: S104P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000028167
Gene: ENSMUSG00000026827
AA Change: S104P

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	145	5.2e-7	PFAM
Pfam:FAD_oxidored	71	147	2.3e-9	PFAM
Pfam:DAO	71	441	8.9e-52	PFAM
EFh	627	655	1.38e1	SMART
EFh	663	691	1.27e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112618
AA Change: S104P

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000108237
Gene: ENSMUSG00000026827
AA Change: S104P

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	143	4.6e-7	PFAM
Pfam:DAO	71	441	2.9e-50	PFAM
Pfam:DAO_C	462	588	2.1e-42	PFAM
EFh	645	673	1.38e1	SMART
EFh	681	709	1.27e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141536

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148991

Predicted Effect

probably damaging
Transcript: ENSMUST00000169687
AA Change: S104P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000130992
Gene: ENSMUSG00000026827
AA Change: S104P

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	145	5.2e-7	PFAM
Pfam:FAD_oxidored	71	147	2.3e-9	PFAM
Pfam:DAO	71	441	8.9e-52	PFAM
EFh	627	655	1.38e1	SMART
EFh	663	691	1.27e-3	SMART

Meta Mutation Damage Score

0.7411

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (30/30)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the inner mitochondrial membrane and catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate, using FAD as a cofactor. Along with GDP1, the encoded protein constitutes the glycerol phosphate shuttle, which reoxidizes NADH formed during glycolysis. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit diminished hepatic ATP levels, decreased adiposity and fasting blood glucose, and, on an inbred background, reductions in preweaning viability and fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acoxl	T	C	2: 128,123,024	I596T	probably benign	Het
Arhgef4	G	A	1: 34,723,477	A605T	unknown	Het
Birc7	G	A	2: 180,929,450	D102N	probably benign	Het
Cct8	A	C	16: 87,495,727		probably null	Het
Cntn5	T	C	9: 10,144,323		probably null	Het
Cyp11a1	A	G	9: 58,025,568	N396D	probably benign	Het
Dip2b	T	C	15: 100,154,282	S255P	probably benign	Het
Dnajc14	A	G	10: 128,807,490	E427G	probably damaging	Het
Fancm	T	A	12: 65,125,052	M1822K	probably damaging	Het
Far2	T	C	6: 148,157,497	V227A	probably benign	Het
Fbrsl1	A	G	5: 110,377,407	F100L	probably damaging	Het
Gm5771	T	C	6: 41,396,656	V151A	probably benign	Het
Grp	T	C	18: 65,873,753		probably null	Het
Hamp	A	C	7: 30,943,903	H27Q	probably benign	Het
Hecw1	T	A	13: 14,316,446	S241C	probably damaging	Het
Itsn2	T	A	12: 4,706,351	I1349N	probably damaging	Het
Nr4a2	A	G	2: 57,112,418	Y8H	probably damaging	Het
Olfr263	A	T	13: 21,133,075	Q100L	probably damaging	Het
Olfr320	T	A	11: 58,684,528	Y218*	probably null	Het
Pla2g2e	T	C	4: 138,880,425	Y39H	probably damaging	Het
Plch1	C	T	3: 63,781,390	W131*	probably null	Het
Ptpn20	A	T	14: 33,631,005	T234S	possibly damaging	Het
Smarca2	T	A	19: 26,678,363	V810E	probably damaging	Het
Taar2	A	T	10: 23,940,717	M52L	probably benign	Het
Tex47	A	T	5: 7,304,935	R39*	probably null	Het
Tnxb	T	A	17: 34,692,424	V1567D	probably damaging	Het
Ttll6	T	C	11: 96,135,505	Y79H	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Zfp462	C	T	4: 55,080,680	T1344I	probably benign	Het
Zfp804a	A	T	2: 82,257,038	I404L	possibly damaging	Het

Other mutations in Gpd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Gpd2	APN	2	57268084	critical splice donor site	probably null
IGL01012:Gpd2	APN	2	57364530	missense	probably benign	0.00
IGL01096:Gpd2	APN	2	57338867	missense	probably damaging	0.98
IGL01642:Gpd2	APN	2	57268071	nonsense	probably null
IGL01816:Gpd2	APN	2	57364066	nonsense	probably null
IGL02257:Gpd2	APN	2	57364524	missense	probably benign	0.01
IGL02824:Gpd2	APN	2	57364327	missense	probably null	0.89
IGL02832:Gpd2	APN	2	57338979	missense	probably damaging	1.00
IGL03040:Gpd2	APN	2	57355793	missense	probably benign	0.06
IGL03107:Gpd2	APN	2	57355569	missense	probably damaging	1.00
IGL03131:Gpd2	APN	2	57338843	splice site	probably benign
IGL03218:Gpd2	APN	2	57307054	missense	probably damaging	1.00
IGL03226:Gpd2	APN	2	57304486	critical splice donor site	probably null
IGL03372:Gpd2	APN	2	57355507	missense	probably damaging	1.00
R0012:Gpd2	UTSW	2	57338868	missense	probably damaging	1.00
R0285:Gpd2	UTSW	2	57338955	missense	probably benign	0.16
R0379:Gpd2	UTSW	2	57345263	missense	probably damaging	1.00
R0401:Gpd2	UTSW	2	57340093	missense	possibly damaging	0.94
R1347:Gpd2	UTSW	2	57357671	missense	probably damaging	0.99
R1347:Gpd2	UTSW	2	57357671	missense	probably damaging	0.99
R1468:Gpd2	UTSW	2	57355774	missense	probably damaging	1.00
R1468:Gpd2	UTSW	2	57355774	missense	probably damaging	1.00
R1490:Gpd2	UTSW	2	57355475	missense	probably damaging	1.00
R1672:Gpd2	UTSW	2	57357700	missense	probably damaging	0.97
R1709:Gpd2	UTSW	2	57357655	missense	probably damaging	1.00
R1735:Gpd2	UTSW	2	57355551	missense	probably damaging	1.00
R2056:Gpd2	UTSW	2	57339013	critical splice donor site	probably null
R2959:Gpd2	UTSW	2	57338975	nonsense	probably null
R2960:Gpd2	UTSW	2	57338975	nonsense	probably null
R2961:Gpd2	UTSW	2	57338975	nonsense	probably null
R2962:Gpd2	UTSW	2	57338975	nonsense	probably null
R3008:Gpd2	UTSW	2	57338975	nonsense	probably null
R3009:Gpd2	UTSW	2	57338975	nonsense	probably null
R3881:Gpd2	UTSW	2	57338975	nonsense	probably null
R4073:Gpd2	UTSW	2	57290013	missense	probably damaging	1.00
R4153:Gpd2	UTSW	2	57355771	missense	probably damaging	1.00
R4564:Gpd2	UTSW	2	57307083	missense	possibly damaging	0.77
R4952:Gpd2	UTSW	2	57307013	nonsense	probably null
R5030:Gpd2	UTSW	2	57304405	missense	probably damaging	0.98
R5101:Gpd2	UTSW	2	57355901	missense	probably damaging	1.00
R5185:Gpd2	UTSW	2	57340204	missense	probably damaging	1.00
R6020:Gpd2	UTSW	2	57364513	missense	probably benign	0.18
R6536:Gpd2	UTSW	2	57345355	missense	probably benign	0.40
R6923:Gpd2	UTSW	2	57355788	missense	probably damaging	0.98
R7058:Gpd2	UTSW	2	57307100	splice site	probably null
R7380:Gpd2	UTSW	2	57340159	missense	probably damaging	1.00
R8052:Gpd2	UTSW	2	57306950	nonsense	probably null
R8098:Gpd2	UTSW	2	57290008	missense	possibly damaging	0.94
R8467:Gpd2	UTSW	2	57364584	missense	possibly damaging	0.95
R8851:Gpd2	UTSW	2	57307050	missense	possibly damaging	0.62
R9515:Gpd2	UTSW	2	57305854	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- TGACTTGTCCCTCAGGAAGAGC -3'
(R):5'- TCCTGAAAGATGCTCCAAGC -3'

Sequencing Primer
(F):5'- TACCCTGGAGAAGTGCTT -3'
(R):5'- TGATAGCCTTCTGGAGGT -3'

Posted On

2018-04-02