Incidental Mutation 'R6325:Gpd2'
ID510225
Institutional Source Beutler Lab
Gene Symbol Gpd2
Ensembl Gene ENSMUSG00000026827
Gene Nameglycerol phosphate dehydrogenase 2, mitochondrial
SynonymsGdm1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.535) question?
Stock #R6325 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location57237635-57370719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57304396 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 104 (S104P)
Ref Sequence ENSEMBL: ENSMUSP00000130992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028167] [ENSMUST00000112618] [ENSMUST00000169687]
Predicted Effect probably damaging
Transcript: ENSMUST00000028167
AA Change: S104P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028167
Gene: ENSMUSG00000026827
AA Change: S104P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 145 5.2e-7 PFAM
Pfam:FAD_oxidored 71 147 2.3e-9 PFAM
Pfam:DAO 71 441 8.9e-52 PFAM
EFh 627 655 1.38e1 SMART
EFh 663 691 1.27e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112618
AA Change: S104P

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108237
Gene: ENSMUSG00000026827
AA Change: S104P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 143 4.6e-7 PFAM
Pfam:DAO 71 441 2.9e-50 PFAM
Pfam:DAO_C 462 588 2.1e-42 PFAM
EFh 645 673 1.38e1 SMART
EFh 681 709 1.27e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148991
Predicted Effect probably damaging
Transcript: ENSMUST00000169687
AA Change: S104P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130992
Gene: ENSMUSG00000026827
AA Change: S104P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 145 5.2e-7 PFAM
Pfam:FAD_oxidored 71 147 2.3e-9 PFAM
Pfam:DAO 71 441 8.9e-52 PFAM
EFh 627 655 1.38e1 SMART
EFh 663 691 1.27e-3 SMART
Meta Mutation Damage Score 0.7411 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the inner mitochondrial membrane and catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate, using FAD as a cofactor. Along with GDP1, the encoded protein constitutes the glycerol phosphate shuttle, which reoxidizes NADH formed during glycolysis. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit diminished hepatic ATP levels, decreased adiposity and fasting blood glucose, and, on an inbred background, reductions in preweaning viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,123,024 I596T probably benign Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Birc7 G A 2: 180,929,450 D102N probably benign Het
Cct8 A C 16: 87,495,727 probably null Het
Cntn5 T C 9: 10,144,323 probably null Het
Cyp11a1 A G 9: 58,025,568 N396D probably benign Het
Dip2b T C 15: 100,154,282 S255P probably benign Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Fancm T A 12: 65,125,052 M1822K probably damaging Het
Far2 T C 6: 148,157,497 V227A probably benign Het
Fbrsl1 A G 5: 110,377,407 F100L probably damaging Het
Gm5771 T C 6: 41,396,656 V151A probably benign Het
Grp T C 18: 65,873,753 probably null Het
Hamp A C 7: 30,943,903 H27Q probably benign Het
Hecw1 T A 13: 14,316,446 S241C probably damaging Het
Itsn2 T A 12: 4,706,351 I1349N probably damaging Het
Nr4a2 A G 2: 57,112,418 Y8H probably damaging Het
Olfr263 A T 13: 21,133,075 Q100L probably damaging Het
Olfr320 T A 11: 58,684,528 Y218* probably null Het
Pla2g2e T C 4: 138,880,425 Y39H probably damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Ptpn20 A T 14: 33,631,005 T234S possibly damaging Het
Smarca2 T A 19: 26,678,363 V810E probably damaging Het
Taar2 A T 10: 23,940,717 M52L probably benign Het
Tex47 A T 5: 7,304,935 R39* probably null Het
Tnxb T A 17: 34,692,424 V1567D probably damaging Het
Ttll6 T C 11: 96,135,505 Y79H probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp462 C T 4: 55,080,680 T1344I probably benign Het
Zfp804a A T 2: 82,257,038 I404L possibly damaging Het
Other mutations in Gpd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Gpd2 APN 2 57268084 critical splice donor site probably null
IGL01012:Gpd2 APN 2 57364530 missense probably benign 0.00
IGL01096:Gpd2 APN 2 57338867 missense probably damaging 0.98
IGL01642:Gpd2 APN 2 57268071 nonsense probably null
IGL01816:Gpd2 APN 2 57364066 nonsense probably null
IGL02257:Gpd2 APN 2 57364524 missense probably benign 0.01
IGL02824:Gpd2 APN 2 57364327 missense probably null 0.89
IGL02832:Gpd2 APN 2 57338979 missense probably damaging 1.00
IGL03040:Gpd2 APN 2 57355793 missense probably benign 0.06
IGL03107:Gpd2 APN 2 57355569 missense probably damaging 1.00
IGL03131:Gpd2 APN 2 57338843 splice site probably benign
IGL03218:Gpd2 APN 2 57307054 missense probably damaging 1.00
IGL03226:Gpd2 APN 2 57304486 critical splice donor site probably null
IGL03372:Gpd2 APN 2 57355507 missense probably damaging 1.00
kraft UTSW 2 57304396 missense probably damaging 0.96
R0012:Gpd2 UTSW 2 57338868 missense probably damaging 1.00
R0285:Gpd2 UTSW 2 57338955 missense probably benign 0.16
R0379:Gpd2 UTSW 2 57345263 missense probably damaging 1.00
R0401:Gpd2 UTSW 2 57340093 missense possibly damaging 0.94
R1347:Gpd2 UTSW 2 57357671 missense probably damaging 0.99
R1347:Gpd2 UTSW 2 57357671 missense probably damaging 0.99
R1468:Gpd2 UTSW 2 57355774 missense probably damaging 1.00
R1468:Gpd2 UTSW 2 57355774 missense probably damaging 1.00
R1490:Gpd2 UTSW 2 57355475 missense probably damaging 1.00
R1672:Gpd2 UTSW 2 57357700 missense probably damaging 0.97
R1709:Gpd2 UTSW 2 57357655 missense probably damaging 1.00
R1735:Gpd2 UTSW 2 57355551 missense probably damaging 1.00
R2056:Gpd2 UTSW 2 57339013 critical splice donor site probably null
R2959:Gpd2 UTSW 2 57338975 nonsense probably null
R2960:Gpd2 UTSW 2 57338975 nonsense probably null
R2961:Gpd2 UTSW 2 57338975 nonsense probably null
R2962:Gpd2 UTSW 2 57338975 nonsense probably null
R3008:Gpd2 UTSW 2 57338975 nonsense probably null
R3009:Gpd2 UTSW 2 57338975 nonsense probably null
R3881:Gpd2 UTSW 2 57338975 nonsense probably null
R4073:Gpd2 UTSW 2 57290013 missense probably damaging 1.00
R4153:Gpd2 UTSW 2 57355771 missense probably damaging 1.00
R4564:Gpd2 UTSW 2 57307083 missense possibly damaging 0.77
R4952:Gpd2 UTSW 2 57307013 nonsense probably null
R5030:Gpd2 UTSW 2 57304405 missense probably damaging 0.98
R5101:Gpd2 UTSW 2 57355901 missense probably damaging 1.00
R5185:Gpd2 UTSW 2 57340204 missense probably damaging 1.00
R6020:Gpd2 UTSW 2 57364513 missense probably benign 0.18
R6536:Gpd2 UTSW 2 57345355 missense probably benign 0.40
R6923:Gpd2 UTSW 2 57355788 missense probably damaging 0.98
R7058:Gpd2 UTSW 2 57307100 splice site probably null
R7380:Gpd2 UTSW 2 57340159 missense probably damaging 1.00
R8052:Gpd2 UTSW 2 57306950 nonsense probably null
R8098:Gpd2 UTSW 2 57290008 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGACTTGTCCCTCAGGAAGAGC -3'
(R):5'- TCCTGAAAGATGCTCCAAGC -3'

Sequencing Primer
(F):5'- TACCCTGGAGAAGTGCTT -3'
(R):5'- TGATAGCCTTCTGGAGGT -3'
Posted On2018-04-02