Incidental Mutation 'R6325:Zfp804a'
ID510226
Institutional Source Beutler Lab
Gene Symbol Zfp804a
Ensembl Gene ENSMUSG00000070866
Gene Namezinc finger protein 804A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R6325 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location82053222-82259879 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82257038 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 404 (I404L)
Ref Sequence ENSEMBL: ENSMUSP00000041941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047527]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047527
AA Change: I404L

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041941
Gene: ENSMUSG00000070866
AA Change: I404L

DomainStartEndE-ValueType
ZnF_C2H2 57 81 7.29e0 SMART
low complexity region 588 595 N/A INTRINSIC
low complexity region 801 808 N/A INTRINSIC
low complexity region 1012 1029 N/A INTRINSIC
low complexity region 1061 1077 N/A INTRINSIC
low complexity region 1168 1191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127187
Meta Mutation Damage Score 0.0958 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger binding protein. Polymorphisms in this gene, especially rs1344706, are thought to confer increased susceptibility to schizophrenia, bipolar disorder, and heroin addiciton. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,123,024 I596T probably benign Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Birc7 G A 2: 180,929,450 D102N probably benign Het
Cct8 A C 16: 87,495,727 probably null Het
Cntn5 T C 9: 10,144,323 probably null Het
Cyp11a1 A G 9: 58,025,568 N396D probably benign Het
Dip2b T C 15: 100,154,282 S255P probably benign Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Fancm T A 12: 65,125,052 M1822K probably damaging Het
Far2 T C 6: 148,157,497 V227A probably benign Het
Fbrsl1 A G 5: 110,377,407 F100L probably damaging Het
Gm5771 T C 6: 41,396,656 V151A probably benign Het
Gpd2 T C 2: 57,304,396 S104P probably damaging Het
Grp T C 18: 65,873,753 probably null Het
Hamp A C 7: 30,943,903 H27Q probably benign Het
Hecw1 T A 13: 14,316,446 S241C probably damaging Het
Itsn2 T A 12: 4,706,351 I1349N probably damaging Het
Nr4a2 A G 2: 57,112,418 Y8H probably damaging Het
Olfr263 A T 13: 21,133,075 Q100L probably damaging Het
Olfr320 T A 11: 58,684,528 Y218* probably null Het
Pla2g2e T C 4: 138,880,425 Y39H probably damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Ptpn20 A T 14: 33,631,005 T234S possibly damaging Het
Smarca2 T A 19: 26,678,363 V810E probably damaging Het
Taar2 A T 10: 23,940,717 M52L probably benign Het
Tex47 A T 5: 7,304,935 R39* probably null Het
Tnxb T A 17: 34,692,424 V1567D probably damaging Het
Ttll6 T C 11: 96,135,505 Y79H probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp462 C T 4: 55,080,680 T1344I probably benign Het
Other mutations in Zfp804a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Zfp804a APN 2 82053875 missense probably benign 0.30
IGL02011:Zfp804a APN 2 82256691 missense probably damaging 1.00
IGL02218:Zfp804a APN 2 82259202 missense probably damaging 1.00
IGL02645:Zfp804a APN 2 82053876 missense possibly damaging 0.94
PIT4431001:Zfp804a UTSW 2 82259192 missense probably benign 0.04
R0027:Zfp804a UTSW 2 82257200 missense probably damaging 1.00
R0167:Zfp804a UTSW 2 82256516 missense probably damaging 1.00
R0437:Zfp804a UTSW 2 82053791 start codon destroyed probably null 0.08
R0521:Zfp804a UTSW 2 82259417 nonsense probably null
R0546:Zfp804a UTSW 2 82258920 missense possibly damaging 0.91
R0609:Zfp804a UTSW 2 82257588 missense probably damaging 1.00
R0694:Zfp804a UTSW 2 82053804 missense probably damaging 1.00
R0837:Zfp804a UTSW 2 82259162 missense probably damaging 1.00
R0947:Zfp804a UTSW 2 82258718 missense possibly damaging 0.58
R1103:Zfp804a UTSW 2 82257500 missense probably damaging 0.99
R1168:Zfp804a UTSW 2 82256697 missense probably benign 0.43
R1365:Zfp804a UTSW 2 82257246 missense probably benign 0.00
R1377:Zfp804a UTSW 2 82258497 missense probably benign 0.39
R1501:Zfp804a UTSW 2 82235799 missense probably damaging 1.00
R1526:Zfp804a UTSW 2 82258188 missense probably benign
R1585:Zfp804a UTSW 2 82053751 start gained probably benign
R1674:Zfp804a UTSW 2 82258824 missense probably benign 0.35
R2058:Zfp804a UTSW 2 82257366 missense probably benign 0.00
R2146:Zfp804a UTSW 2 82258664 missense probably benign 0.02
R2149:Zfp804a UTSW 2 82258664 missense probably benign 0.02
R2171:Zfp804a UTSW 2 82257183 missense possibly damaging 0.77
R2307:Zfp804a UTSW 2 82256857 missense probably benign 0.04
R2398:Zfp804a UTSW 2 82258669 missense possibly damaging 0.95
R2496:Zfp804a UTSW 2 82235844 missense probably damaging 1.00
R2504:Zfp804a UTSW 2 82257519 missense probably benign 0.00
R2919:Zfp804a UTSW 2 82235816 missense probably damaging 1.00
R2943:Zfp804a UTSW 2 82235879 missense probably damaging 1.00
R3116:Zfp804a UTSW 2 82259417 missense probably damaging 1.00
R4170:Zfp804a UTSW 2 82253488 missense probably damaging 1.00
R4393:Zfp804a UTSW 2 82256921 missense probably benign 0.43
R4701:Zfp804a UTSW 2 82256582 missense probably damaging 1.00
R4771:Zfp804a UTSW 2 82257942 missense probably benign 0.01
R4793:Zfp804a UTSW 2 82235842 missense probably damaging 1.00
R5523:Zfp804a UTSW 2 82258995 missense probably damaging 1.00
R5526:Zfp804a UTSW 2 82258590 missense probably benign 0.00
R5961:Zfp804a UTSW 2 82258002 missense probably benign
R6181:Zfp804a UTSW 2 82257142 missense probably damaging 1.00
R6209:Zfp804a UTSW 2 82258118 missense probably damaging 1.00
R7147:Zfp804a UTSW 2 82258187 missense probably benign 0.00
R7229:Zfp804a UTSW 2 82258625 missense probably benign 0.04
R7666:Zfp804a UTSW 2 82259060 nonsense probably null
R7910:Zfp804a UTSW 2 82256573 missense probably damaging 1.00
R8256:Zfp804a UTSW 2 82053849 missense probably damaging 0.99
X0064:Zfp804a UTSW 2 82235823 missense probably damaging 1.00
Z1177:Zfp804a UTSW 2 82258563 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGGACCTGTGAGTAAAAGCAAC -3'
(R):5'- TCCTTCTGTTCAGAGAAAAGGTC -3'

Sequencing Primer
(F):5'- TGTGAGTAAAAGCAACCCAAATATC -3'
(R):5'- CATTTCTGATGGCCACTG -3'
Posted On2018-04-02