Incidental Mutation 'R6325:Ptpn20'
ID510246
Institutional Source Beutler Lab
Gene Symbol Ptpn20
Ensembl Gene ENSMUSG00000021940
Gene Nameprotein tyrosine phosphatase, non-receptor type 20
Synonymstyp
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6325 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location33589207-33640754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33631005 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 234 (T234S)
Ref Sequence ENSEMBL: ENSMUSP00000022508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022508] [ENSMUST00000226512] [ENSMUST00000227887]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022508
AA Change: T234S

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022508
Gene: ENSMUSG00000021940
AA Change: T234S

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PTPc 164 420 1.12e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226512
Predicted Effect probably benign
Transcript: ENSMUST00000227887
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of classical tyrosine-specific protein tyrosine phosphatases. Many protein tyrosine phosphatases have been shown to regulate fundamental cellular processes. The encoded protein appears to be targeted to sites of actin polymerization. A pseudogene of this gene has been defined on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,123,024 I596T probably benign Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Birc7 G A 2: 180,929,450 D102N probably benign Het
Cct8 A C 16: 87,495,727 probably null Het
Cntn5 T C 9: 10,144,323 probably null Het
Cyp11a1 A G 9: 58,025,568 N396D probably benign Het
Dip2b T C 15: 100,154,282 S255P probably benign Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Fancm T A 12: 65,125,052 M1822K probably damaging Het
Far2 T C 6: 148,157,497 V227A probably benign Het
Fbrsl1 A G 5: 110,377,407 F100L probably damaging Het
Gm5771 T C 6: 41,396,656 V151A probably benign Het
Gpd2 T C 2: 57,304,396 S104P probably damaging Het
Grp T C 18: 65,873,753 probably null Het
Hamp A C 7: 30,943,903 H27Q probably benign Het
Hecw1 T A 13: 14,316,446 S241C probably damaging Het
Itsn2 T A 12: 4,706,351 I1349N probably damaging Het
Nr4a2 A G 2: 57,112,418 Y8H probably damaging Het
Olfr263 A T 13: 21,133,075 Q100L probably damaging Het
Olfr320 T A 11: 58,684,528 Y218* probably null Het
Pla2g2e T C 4: 138,880,425 Y39H probably damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Smarca2 T A 19: 26,678,363 V810E probably damaging Het
Taar2 A T 10: 23,940,717 M52L probably benign Het
Tex47 A T 5: 7,304,935 R39* probably null Het
Tnxb T A 17: 34,692,424 V1567D probably damaging Het
Ttll6 T C 11: 96,135,505 Y79H probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp462 C T 4: 55,080,680 T1344I probably benign Het
Zfp804a A T 2: 82,257,038 I404L possibly damaging Het
Other mutations in Ptpn20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Ptpn20 APN 14 33622619 missense probably benign 0.22
IGL01510:Ptpn20 APN 14 33638386 splice site probably null
R2057:Ptpn20 UTSW 14 33630985 missense probably damaging 0.98
R2262:Ptpn20 UTSW 14 33612311 missense probably benign
R3106:Ptpn20 UTSW 14 33612296 missense probably benign
R3430:Ptpn20 UTSW 14 33614528 missense possibly damaging 0.61
R4645:Ptpn20 UTSW 14 33631212 missense probably benign
R4928:Ptpn20 UTSW 14 33614489 missense probably benign 0.00
R4962:Ptpn20 UTSW 14 33614459 missense probably benign 0.02
R5087:Ptpn20 UTSW 14 33614441 missense possibly damaging 0.90
R5163:Ptpn20 UTSW 14 33631111 missense probably benign 0.07
R5275:Ptpn20 UTSW 14 33631192 missense probably benign 0.00
R6651:Ptpn20 UTSW 14 33632940 missense probably damaging 1.00
R6831:Ptpn20 UTSW 14 33632925 missense probably damaging 1.00
R6903:Ptpn20 UTSW 14 33614504 missense probably damaging 0.98
R7034:Ptpn20 UTSW 14 33614435 makesense probably null
R7036:Ptpn20 UTSW 14 33614435 makesense probably null
R7265:Ptpn20 UTSW 14 33614524 missense probably benign 0.05
R7654:Ptpn20 UTSW 14 33638324 missense probably benign 0.18
R7735:Ptpn20 UTSW 14 33630945 missense probably damaging 1.00
R7761:Ptpn20 UTSW 14 33622552 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GCTTTCACAAAGTCTGGGTAGC -3'
(R):5'- CTTCACAATCTGAAATACTCGAACG -3'

Sequencing Primer
(F):5'- TTCACAAAGTCTGGGTAGCTCAGC -3'
(R):5'- TGAGTTACATGAAAGGTCTCCAG -3'
Posted On2018-04-02