Incidental Mutation 'R6325:Dip2b'
ID 510247
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.709) question?
Stock # R6325 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 100038664-100219473 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100154282 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 255 (S255P)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203]
AlphaFold Q3UH60
Predicted Effect probably benign
Transcript: ENSMUST00000023768
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100203
AA Change: S255P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: S255P

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Meta Mutation Damage Score 0.4381 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,123,024 I596T probably benign Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Birc7 G A 2: 180,929,450 D102N probably benign Het
Cct8 A C 16: 87,495,727 probably null Het
Cntn5 T C 9: 10,144,323 probably null Het
Cyp11a1 A G 9: 58,025,568 N396D probably benign Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Fancm T A 12: 65,125,052 M1822K probably damaging Het
Far2 T C 6: 148,157,497 V227A probably benign Het
Fbrsl1 A G 5: 110,377,407 F100L probably damaging Het
Gm5771 T C 6: 41,396,656 V151A probably benign Het
Gpd2 T C 2: 57,304,396 S104P probably damaging Het
Grp T C 18: 65,873,753 probably null Het
Hamp A C 7: 30,943,903 H27Q probably benign Het
Hecw1 T A 13: 14,316,446 S241C probably damaging Het
Itsn2 T A 12: 4,706,351 I1349N probably damaging Het
Nr4a2 A G 2: 57,112,418 Y8H probably damaging Het
Olfr263 A T 13: 21,133,075 Q100L probably damaging Het
Olfr320 T A 11: 58,684,528 Y218* probably null Het
Pla2g2e T C 4: 138,880,425 Y39H probably damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Ptpn20 A T 14: 33,631,005 T234S possibly damaging Het
Smarca2 T A 19: 26,678,363 V810E probably damaging Het
Taar2 A T 10: 23,940,717 M52L probably benign Het
Tex47 A T 5: 7,304,935 R39* probably null Het
Tnxb T A 17: 34,692,424 V1567D probably damaging Het
Ttll6 T C 11: 96,135,505 Y79H probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp462 C T 4: 55,080,680 T1344I probably benign Het
Zfp804a A T 2: 82,257,038 I404L possibly damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100174501 missense probably damaging 1.00
IGL01716:Dip2b APN 15 100209636 missense probably benign 0.00
IGL01893:Dip2b APN 15 100171220 splice site probably benign
IGL01915:Dip2b APN 15 100178511 missense probably damaging 1.00
IGL02125:Dip2b APN 15 100186250 missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100151202 missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100157281 missense probably damaging 1.00
IGL02571:Dip2b APN 15 100157885 missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100215311 missense probably damaging 0.98
IGL02983:Dip2b APN 15 100132022 missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100203127 splice site probably benign
IGL03181:Dip2b APN 15 100215207 missense probably damaging 0.98
IGL03229:Dip2b APN 15 100207838 splice site probably benign
IGL03399:Dip2b APN 15 100175327 missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100202352 missense probably damaging 1.00
R0009:Dip2b UTSW 15 100169312 missense probably damaging 1.00
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0092:Dip2b UTSW 15 100202265 missense probably damaging 1.00
R0201:Dip2b UTSW 15 100186147 missense probably damaging 0.98
R0359:Dip2b UTSW 15 100211993 missense probably damaging 0.98
R0390:Dip2b UTSW 15 100193913 missense probably damaging 0.99
R0564:Dip2b UTSW 15 100162719 nonsense probably null
R0730:Dip2b UTSW 15 100171651 missense probably damaging 1.00
R1144:Dip2b UTSW 15 100154250 missense probably benign 0.11
R1200:Dip2b UTSW 15 100209745 missense probably benign 0.00
R1506:Dip2b UTSW 15 100183113 missense probably damaging 1.00
R1750:Dip2b UTSW 15 100178466 missense probably benign
R1760:Dip2b UTSW 15 100212029 missense probably damaging 1.00
R1773:Dip2b UTSW 15 100193961 missense probably benign 0.00
R1812:Dip2b UTSW 15 100198938 splice site probably null
R2264:Dip2b UTSW 15 100203216 missense probably benign 0.05
R3105:Dip2b UTSW 15 100142137 nonsense probably null
R4029:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4030:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4296:Dip2b UTSW 15 100181336 missense probably benign
R4392:Dip2b UTSW 15 100162036 missense probably damaging 1.00
R4480:Dip2b UTSW 15 100186301 missense probably damaging 0.99
R4564:Dip2b UTSW 15 100157258 nonsense probably null
R4605:Dip2b UTSW 15 100209636 missense probably benign 0.00
R4606:Dip2b UTSW 15 100215329 missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100160491 missense probably damaging 1.00
R4667:Dip2b UTSW 15 100151360 missense probably benign 0.01
R4739:Dip2b UTSW 15 100207777 missense probably damaging 0.98
R4826:Dip2b UTSW 15 100169281 missense probably damaging 0.99
R4870:Dip2b UTSW 15 100195784 splice site probably null
R4877:Dip2b UTSW 15 100160529 missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100171722 missense probably damaging 1.00
R5009:Dip2b UTSW 15 100195784 splice site probably null
R5169:Dip2b UTSW 15 100205113 missense probably damaging 1.00
R5216:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5218:Dip2b UTSW 15 100154296 missense probably benign 0.00
R5274:Dip2b UTSW 15 100212104 missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5420:Dip2b UTSW 15 100205173 intron probably benign
R5447:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5670:Dip2b UTSW 15 100190104 missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100157945 missense probably benign 0.32
R5908:Dip2b UTSW 15 100151184 missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100209694 missense probably benign 0.03
R5987:Dip2b UTSW 15 100190079 missense probably damaging 1.00
R6260:Dip2b UTSW 15 100162702 missense probably benign 0.05
R6367:Dip2b UTSW 15 100115914 missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100151276 missense probably damaging 1.00
R6422:Dip2b UTSW 15 100199011 missense probably damaging 0.98
R6818:Dip2b UTSW 15 100193954 missense probably benign 0.09
R6922:Dip2b UTSW 15 100193843 missense probably benign 0.25
R7002:Dip2b UTSW 15 100160465 missense probably benign 0.43
R7076:Dip2b UTSW 15 100157972 splice site probably null
R7176:Dip2b UTSW 15 100169318 missense probably damaging 1.00
R7255:Dip2b UTSW 15 100209627 missense probably benign 0.00
R7463:Dip2b UTSW 15 100154157 missense probably benign
R7513:Dip2b UTSW 15 100207748 splice site probably null
R7876:Dip2b UTSW 15 100191041 missense probably benign 0.02
R8368:Dip2b UTSW 15 100154243 missense probably benign 0.00
R9289:Dip2b UTSW 15 100173271 missense probably damaging 0.97
R9405:Dip2b UTSW 15 100195876 missense probably benign 0.05
R9477:Dip2b UTSW 15 100038903 missense probably damaging 1.00
R9485:Dip2b UTSW 15 100155043 missense probably benign 0.05
R9533:Dip2b UTSW 15 100175297 missense probably benign 0.06
R9581:Dip2b UTSW 15 100181374 missense probably damaging 0.99
R9666:Dip2b UTSW 15 100209580 missense probably damaging 1.00
X0064:Dip2b UTSW 15 100115850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGTTTTAAAAGAGCGAGTG -3'
(R):5'- ACCAAGAGGGCTCCACATAG -3'

Sequencing Primer
(F):5'- TCCTTCAAAAGCAATGGGTGTAG -3'
(R):5'- GCTCCACATAGTGATGAGTGACC -3'
Posted On 2018-04-02