Incidental Mutation 'R6318:Plcd4'
ID510254
Institutional Source Beutler Lab
Gene Symbol Plcd4
Ensembl Gene ENSMUSG00000026173
Gene Namephospholipase C, delta 4
Synonyms4921507K24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6318 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location74542888-74567794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74563594 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 668 (L668F)
Ref Sequence ENSEMBL: ENSMUSP00000109378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027315] [ENSMUST00000027362] [ENSMUST00000066986] [ENSMUST00000067916] [ENSMUST00000113737] [ENSMUST00000113747] [ENSMUST00000113749] [ENSMUST00000113750] [ENSMUST00000127921] [ENSMUST00000141412] [ENSMUST00000152707] [ENSMUST00000156613]
Predicted Effect probably benign
Transcript: ENSMUST00000027315
SMART Domains Protein: ENSMUSP00000027315
Gene: ENSMUSG00000026135

DomainStartEndE-ValueType
ZnF_C2H2 103 127 1.16e1 SMART
ZnF_C2H2 164 186 1.26e-2 SMART
ZnF_C2H2 193 218 7.78e-3 SMART
ZnF_C2H2 223 247 2.29e0 SMART
ZnF_C2H2 250 272 9.96e-1 SMART
low complexity region 317 329 N/A INTRINSIC
ZnF_C2H2 363 385 9.96e-1 SMART
ZnF_C2H2 391 411 1.26e1 SMART
ZnF_C2H2 419 442 1.47e-3 SMART
ZnF_C2H2 453 475 2.75e-3 SMART
ZnF_C2H2 486 511 3.34e-2 SMART
ZnF_C2H2 516 540 4.81e0 SMART
ZnF_C2H2 543 566 7.05e-1 SMART
ZnF_C2H2 572 595 2.17e-1 SMART
ZnF_C2H2 601 623 1.56e-2 SMART
ZnF_C2H2 629 651 8.94e-3 SMART
ZnF_C2H2 657 679 1.38e-3 SMART
ZnF_C2H2 685 707 9.44e-2 SMART
ZnF_C2H2 712 735 1.26e-2 SMART
ZnF_C2H2 744 767 1.31e0 SMART
ZnF_C2H2 773 796 2.63e0 SMART
low complexity region 903 919 N/A INTRINSIC
low complexity region 953 969 N/A INTRINSIC
low complexity region 996 1007 N/A INTRINSIC
ZnF_C2H2 1039 1059 2.01e1 SMART
ZnF_C2H2 1069 1089 1.91e1 SMART
low complexity region 1147 1160 N/A INTRINSIC
ZnF_C2H2 1187 1207 2.7e2 SMART
low complexity region 1209 1222 N/A INTRINSIC
ZnF_C2H2 1265 1285 3.56e1 SMART
ZnF_C2H2 1295 1318 4.98e-1 SMART
ZnF_C2H2 1331 1354 2.49e-1 SMART
ZnF_C2H2 1360 1382 1.03e-2 SMART
ZnF_C2H2 1388 1411 5.72e-1 SMART
ZnF_C2H2 1417 1440 6.75e0 SMART
ZnF_C2H2 1446 1469 9.58e-3 SMART
ZnF_C2H2 1488 1511 1.64e-1 SMART
ZnF_C2H2 1514 1536 1.1e-2 SMART
ZnF_C2H2 1540 1563 4.05e-1 SMART
ZnF_C2H2 1580 1602 4.45e0 SMART
ZnF_C2H2 1608 1630 8.81e-2 SMART
ZnF_C2H2 1636 1658 1.18e-2 SMART
ZnF_C2H2 1664 1686 1.2e-3 SMART
ZnF_C2H2 1692 1715 3.89e-3 SMART
ZnF_C2H2 1721 1743 4.54e-4 SMART
ZnF_C2H2 1749 1771 1.18e-2 SMART
ZnF_C2H2 1777 1799 3.52e-1 SMART
low complexity region 1829 1838 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000027362
AA Change: L668F

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027362
Gene: ENSMUSG00000026173
AA Change: L668F

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 538 654 1.26e-75 SMART
C2 673 779 5.68e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066986
SMART Domains Protein: ENSMUSP00000065149
Gene: ENSMUSG00000026135

DomainStartEndE-ValueType
low complexity region 116 128 N/A INTRINSIC
ZnF_C2H2 162 184 9.96e-1 SMART
ZnF_C2H2 190 210 1.26e1 SMART
ZnF_C2H2 218 241 1.47e-3 SMART
ZnF_C2H2 252 274 2.75e-3 SMART
ZnF_C2H2 285 310 3.34e-2 SMART
ZnF_C2H2 315 339 4.81e0 SMART
ZnF_C2H2 342 365 7.05e-1 SMART
ZnF_C2H2 371 394 2.17e-1 SMART
ZnF_C2H2 400 422 1.56e-2 SMART
ZnF_C2H2 428 450 8.94e-3 SMART
ZnF_C2H2 456 478 1.38e-3 SMART
ZnF_C2H2 484 506 9.44e-2 SMART
ZnF_C2H2 511 534 1.26e-2 SMART
ZnF_C2H2 543 566 1.31e0 SMART
ZnF_C2H2 572 595 2.63e0 SMART
low complexity region 702 718 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
low complexity region 795 806 N/A INTRINSIC
ZnF_C2H2 838 858 2.01e1 SMART
ZnF_C2H2 868 888 1.91e1 SMART
low complexity region 946 959 N/A INTRINSIC
ZnF_C2H2 986 1006 2.7e2 SMART
low complexity region 1008 1021 N/A INTRINSIC
ZnF_C2H2 1064 1084 3.56e1 SMART
ZnF_C2H2 1094 1117 4.98e-1 SMART
ZnF_C2H2 1130 1153 2.49e-1 SMART
ZnF_C2H2 1159 1181 1.03e-2 SMART
ZnF_C2H2 1187 1210 5.72e-1 SMART
ZnF_C2H2 1216 1239 6.75e0 SMART
ZnF_C2H2 1245 1268 9.58e-3 SMART
ZnF_C2H2 1287 1310 1.64e-1 SMART
ZnF_C2H2 1313 1335 1.1e-2 SMART
ZnF_C2H2 1339 1362 4.05e-1 SMART
ZnF_C2H2 1379 1401 4.45e0 SMART
ZnF_C2H2 1407 1429 8.81e-2 SMART
ZnF_C2H2 1435 1457 1.18e-2 SMART
ZnF_C2H2 1463 1485 1.2e-3 SMART
ZnF_C2H2 1491 1514 3.89e-3 SMART
ZnF_C2H2 1520 1542 4.54e-4 SMART
ZnF_C2H2 1548 1570 1.18e-2 SMART
ZnF_C2H2 1576 1598 3.52e-1 SMART
low complexity region 1628 1637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067916
AA Change: L636F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000064413
Gene: ENSMUSG00000026173
AA Change: L636F

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 506 622 1.26e-75 SMART
C2 641 747 5.68e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113737
SMART Domains Protein: ENSMUSP00000109366
Gene: ENSMUSG00000026135

DomainStartEndE-ValueType
ZnF_C2H2 93 115 9.81e1 SMART
ZnF_C2H2 120 144 2.29e0 SMART
ZnF_C2H2 147 169 9.96e-1 SMART
low complexity region 214 226 N/A INTRINSIC
ZnF_C2H2 260 282 9.96e-1 SMART
ZnF_C2H2 288 308 1.26e1 SMART
ZnF_C2H2 316 339 1.47e-3 SMART
ZnF_C2H2 350 372 2.75e-3 SMART
ZnF_C2H2 383 408 3.34e-2 SMART
ZnF_C2H2 413 437 4.81e0 SMART
ZnF_C2H2 440 463 7.05e-1 SMART
ZnF_C2H2 469 492 2.17e-1 SMART
ZnF_C2H2 498 520 1.56e-2 SMART
ZnF_C2H2 526 548 8.94e-3 SMART
ZnF_C2H2 554 576 1.38e-3 SMART
ZnF_C2H2 582 604 9.44e-2 SMART
ZnF_C2H2 609 632 1.26e-2 SMART
ZnF_C2H2 641 664 1.31e0 SMART
ZnF_C2H2 670 693 2.63e0 SMART
low complexity region 800 816 N/A INTRINSIC
low complexity region 850 866 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
ZnF_C2H2 936 956 2.01e1 SMART
ZnF_C2H2 966 986 1.91e1 SMART
low complexity region 1044 1057 N/A INTRINSIC
ZnF_C2H2 1084 1104 2.7e2 SMART
low complexity region 1106 1119 N/A INTRINSIC
ZnF_C2H2 1162 1182 3.56e1 SMART
ZnF_C2H2 1192 1215 4.98e-1 SMART
ZnF_C2H2 1228 1251 2.49e-1 SMART
ZnF_C2H2 1257 1279 1.03e-2 SMART
ZnF_C2H2 1285 1308 5.72e-1 SMART
ZnF_C2H2 1314 1337 6.75e0 SMART
ZnF_C2H2 1343 1366 9.58e-3 SMART
ZnF_C2H2 1385 1408 1.64e-1 SMART
ZnF_C2H2 1411 1433 1.1e-2 SMART
ZnF_C2H2 1437 1460 4.05e-1 SMART
ZnF_C2H2 1477 1499 4.45e0 SMART
ZnF_C2H2 1505 1527 8.81e-2 SMART
ZnF_C2H2 1533 1555 1.18e-2 SMART
ZnF_C2H2 1561 1583 1.2e-3 SMART
ZnF_C2H2 1589 1612 3.89e-3 SMART
ZnF_C2H2 1618 1640 4.54e-4 SMART
ZnF_C2H2 1646 1668 1.18e-2 SMART
ZnF_C2H2 1674 1696 3.52e-1 SMART
low complexity region 1726 1735 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113745
SMART Domains Protein: ENSMUSP00000109374
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113747
AA Change: L636F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000109376
Gene: ENSMUSG00000026173
AA Change: L636F

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 506 622 1.26e-75 SMART
C2 641 747 5.68e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113749
AA Change: L668F

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109378
Gene: ENSMUSG00000026173
AA Change: L668F

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 538 654 1.26e-75 SMART
C2 673 779 5.68e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113750
AA Change: L636F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000109379
Gene: ENSMUSG00000026173
AA Change: L636F

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 506 622 1.26e-75 SMART
C2 641 747 7.16e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135111
Predicted Effect probably benign
Transcript: ENSMUST00000141412
SMART Domains Protein: ENSMUSP00000115322
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152707
SMART Domains Protein: ENSMUSP00000121732
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189956
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the delta class of phospholipase C enzymes. Phospholipase C enzymes play a critical role in many cellular processes by hydrolyzing phosphatidylinositol 4,5-bisphosphate into two intracellular second messengers, inositol 1,4,5-trisphosphate and diacylglycerol. Expression of this gene may be a marker for cancer. [provided by RefSeq, Jan 2011]
PHENOTYPE: Males homozygous for a targeted null mutation are subfertile or sterile. Sperm from mutant males fail to initiate the acrosome reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,393,275 T13A possibly damaging Het
Abcg4 T C 9: 44,275,348 T500A probably benign Het
Adcy4 T A 14: 55,769,224 I1051F probably damaging Het
Adgrg6 A T 10: 14,467,497 N235K probably benign Het
Aldh3a2 A C 11: 61,262,419 Y160* probably null Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Armt1 T C 10: 4,450,859 M202T probably benign Het
AU019823 T C 9: 50,607,461 R284G probably benign Het
Brd2 C A 17: 34,112,898 V349F probably damaging Het
Btnl10 A T 11: 58,926,865 probably benign Het
Ccdc178 A G 18: 22,120,534 V216A possibly damaging Het
Ccdc85c A T 12: 108,274,709 L142Q unknown Het
Cdc27 A T 11: 104,528,694 S172T probably damaging Het
Ceacam14 T C 7: 17,814,312 I109T probably damaging Het
Ces5a C T 8: 93,534,583 G72E probably damaging Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clec14a G A 12: 58,268,215 P207L probably damaging Het
Clec16a G A 16: 10,630,788 R599H probably damaging Het
Csmd1 A T 8: 15,903,212 I3423N probably damaging Het
Cyp4a29 C A 4: 115,250,199 N243K probably benign Het
Ddx59 T C 1: 136,416,872 F94L probably damaging Het
Dusp3 A C 11: 101,986,871 V19G probably benign Het
Fat3 T C 9: 15,916,984 probably benign Het
Fgfr4 T A 13: 55,166,108 V545E probably damaging Het
Fxn G T 19: 24,280,426 A47D probably damaging Het
Gdpgp1 A T 7: 80,239,150 I310F possibly damaging Het
Gm7210 A T 7: 11,594,113 noncoding transcript Het
Grm7 G T 6: 111,358,875 C749F probably damaging Het
Hps4 T G 5: 112,346,629 V26G probably damaging Het
Igf1r A G 7: 68,165,233 D294G probably benign Het
Immp1l T C 2: 105,930,827 F27S probably benign Het
Kcnk3 T A 5: 30,622,586 C327S probably damaging Het
Kif13a T A 13: 46,815,207 probably null Het
Krtap5-4 T C 7: 142,304,090 S166P unknown Het
Lyst G A 13: 13,743,311 D3319N possibly damaging Het
Malrd1 T G 2: 16,042,267 S1735A unknown Het
Myh4 A G 11: 67,243,442 T308A probably benign Het
Myh8 A T 11: 67,299,341 Q1269L probably benign Het
Myo15b G A 11: 115,890,831 V1367I probably damaging Het
Nae1 T C 8: 104,523,637 D208G probably benign Het
Nelfe T A 17: 34,854,456 V296D probably damaging Het
Npepps A T 11: 97,218,548 V734E probably damaging Het
Ogdh A G 11: 6,349,390 N752S probably damaging Het
Olfr1094 A G 2: 86,829,654 I301V possibly damaging Het
Olfr266 T C 3: 106,822,187 D124G probably damaging Het
Olfr401 A T 11: 74,121,721 Q144L possibly damaging Het
Olfr906 T C 9: 38,488,377 M116T probably benign Het
Otof C A 5: 30,414,544 G171V probably damaging Het
Phtf2 A T 5: 20,801,941 V208D probably damaging Het
Pkn1 T A 8: 83,683,591 T340S probably damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prss50 A T 9: 110,861,299 D170V probably damaging Het
Ptprg T C 14: 12,237,118 V604A probably damaging Het
Rab33b T C 3: 51,493,405 V100A probably damaging Het
Rbm26 T A 14: 105,131,535 D736V probably damaging Het
Rela C A 19: 5,646,964 P400T probably benign Het
Rpusd4 T C 9: 35,268,038 L50P probably damaging Het
Scn10a A C 9: 119,627,115 Y1214D probably damaging Het
Sema3c A G 5: 17,672,432 E179G probably damaging Het
Skint5 T A 4: 113,517,133 D1253V unknown Het
Sp4 G T 12: 118,238,178 P771H probably damaging Het
Sphkap T A 1: 83,278,378 Y263F probably damaging Het
Ssbp1 G A 6: 40,476,753 V78I probably benign Het
St3gal6 A G 16: 58,486,406 I87T probably benign Het
Tango6 T A 8: 106,818,497 D997E probably benign Het
Tpr C T 1: 150,445,888 P2265S possibly damaging Het
Ttc7b A T 12: 100,325,677 F212Y probably damaging Het
Ubc A G 5: 125,388,260 M1T probably null Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Yes1 T C 5: 32,651,686 I132T possibly damaging Het
Ythdc2 A G 18: 44,860,377 T830A probably benign Het
Zbtb41 T A 1: 139,430,306 F451I possibly damaging Het
Zfp995 C T 17: 21,880,512 C247Y probably benign Het
Other mutations in Plcd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Plcd4 APN 1 74552115 missense probably damaging 1.00
IGL01806:Plcd4 APN 1 74552033 missense probably benign 0.42
IGL02537:Plcd4 APN 1 74556050 missense possibly damaging 0.55
IGL02574:Plcd4 APN 1 74564380 missense probably damaging 1.00
IGL02812:Plcd4 APN 1 74557808 missense probably damaging 1.00
IGL03350:Plcd4 APN 1 74549301 missense probably damaging 1.00
R0415:Plcd4 UTSW 1 74552097 missense probably damaging 0.99
R1699:Plcd4 UTSW 1 74548235 missense probably benign 0.01
R1852:Plcd4 UTSW 1 74549361 missense possibly damaging 0.92
R2120:Plcd4 UTSW 1 74564425 missense probably benign 0.00
R2125:Plcd4 UTSW 1 74565152 missense probably damaging 1.00
R3023:Plcd4 UTSW 1 74548192 missense probably damaging 1.00
R3157:Plcd4 UTSW 1 74551154 splice site probably null
R4535:Plcd4 UTSW 1 74563468 missense probably damaging 1.00
R4581:Plcd4 UTSW 1 74548224 missense probably damaging 1.00
R4863:Plcd4 UTSW 1 74565802 unclassified probably null
R4911:Plcd4 UTSW 1 74564413 missense possibly damaging 0.78
R4987:Plcd4 UTSW 1 74547959 unclassified probably benign
R5102:Plcd4 UTSW 1 74565154 missense probably damaging 1.00
R5752:Plcd4 UTSW 1 74547972 splice site probably null
R5887:Plcd4 UTSW 1 74551090 missense probably damaging 1.00
R6648:Plcd4 UTSW 1 74552013 missense probably benign 0.00
R6796:Plcd4 UTSW 1 74562070 missense probably benign 0.03
R6920:Plcd4 UTSW 1 74565835 unclassified probably benign
R7047:Plcd4 UTSW 1 74551989 missense possibly damaging 0.87
R7121:Plcd4 UTSW 1 74565365 missense probably benign
R7134:Plcd4 UTSW 1 74554503 missense probably benign 0.05
R7270:Plcd4 UTSW 1 74554679 missense possibly damaging 0.89
R7344:Plcd4 UTSW 1 74554652 missense probably damaging 1.00
R7363:Plcd4 UTSW 1 74551072 missense probably null 0.99
R7749:Plcd4 UTSW 1 74565133 missense possibly damaging 0.60
R8240:Plcd4 UTSW 1 74554501 missense probably benign 0.38
Z1176:Plcd4 UTSW 1 74548126 missense probably benign 0.04
Z1176:Plcd4 UTSW 1 74557792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATGCATGTAATACACACATACC -3'
(R):5'- AGGTGTATGCTACCACTCCTG -3'

Sequencing Primer
(F):5'- AGACTAGGACAGTGTTAACCTTGTG -3'
(R):5'- ACTCCTGGTAGAGAATTCTCAAC -3'
Posted On2018-04-02