Incidental Mutation 'R6318:Sema3c'
ID510267
Institutional Source Beutler Lab
Gene Symbol Sema3c
Ensembl Gene ENSMUSG00000028780
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
Synonyms1110036B02Rik, Semae
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6318 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location17574281-17730268 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17672432 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 179 (E179G)
Ref Sequence ENSEMBL: ENSMUSP00000132330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030568] [ENSMUST00000169603] [ENSMUST00000170181]
Predicted Effect probably benign
Transcript: ENSMUST00000030568
AA Change: E181G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030568
Gene: ENSMUSG00000028780
AA Change: E181G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Sema 54 495 1.16e-200 SMART
PSI 513 565 2.87e-13 SMART
IG 577 662 7.08e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169603
AA Change: E179G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132330
Gene: ENSMUSG00000028780
AA Change: E179G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Sema 54 226 9.6e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170181
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 99% (74/75)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit perinatal lethality, hypopigmentation and abnormal heart development. Mice homozygous for a knock-out allele exhibit prenatal lethality associated with heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,393,275 T13A possibly damaging Het
Abcg4 T C 9: 44,275,348 T500A probably benign Het
Adcy4 T A 14: 55,769,224 I1051F probably damaging Het
Adgrg6 A T 10: 14,467,497 N235K probably benign Het
Aldh3a2 A C 11: 61,262,419 Y160* probably null Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Armt1 T C 10: 4,450,859 M202T probably benign Het
AU019823 T C 9: 50,607,461 R284G probably benign Het
Brd2 C A 17: 34,112,898 V349F probably damaging Het
Btnl10 A T 11: 58,926,865 probably benign Het
Ccdc178 A G 18: 22,120,534 V216A possibly damaging Het
Ccdc85c A T 12: 108,274,709 L142Q unknown Het
Cdc27 A T 11: 104,528,694 S172T probably damaging Het
Ceacam14 T C 7: 17,814,312 I109T probably damaging Het
Ces5a C T 8: 93,534,583 G72E probably damaging Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clec14a G A 12: 58,268,215 P207L probably damaging Het
Clec16a G A 16: 10,630,788 R599H probably damaging Het
Csmd1 A T 8: 15,903,212 I3423N probably damaging Het
Cyp4a29 C A 4: 115,250,199 N243K probably benign Het
Ddx59 T C 1: 136,416,872 F94L probably damaging Het
Dusp3 A C 11: 101,986,871 V19G probably benign Het
Fat3 T C 9: 15,916,984 probably benign Het
Fgfr4 T A 13: 55,166,108 V545E probably damaging Het
Fxn G T 19: 24,280,426 A47D probably damaging Het
Gdpgp1 A T 7: 80,239,150 I310F possibly damaging Het
Gm7210 A T 7: 11,594,113 noncoding transcript Het
Grm7 G T 6: 111,358,875 C749F probably damaging Het
Hps4 T G 5: 112,346,629 V26G probably damaging Het
Igf1r A G 7: 68,165,233 D294G probably benign Het
Immp1l T C 2: 105,930,827 F27S probably benign Het
Kcnk3 T A 5: 30,622,586 C327S probably damaging Het
Kif13a T A 13: 46,815,207 probably null Het
Krtap5-4 T C 7: 142,304,090 S166P unknown Het
Lyst G A 13: 13,743,311 D3319N possibly damaging Het
Malrd1 T G 2: 16,042,267 S1735A unknown Het
Myh4 A G 11: 67,243,442 T308A probably benign Het
Myh8 A T 11: 67,299,341 Q1269L probably benign Het
Myo15b G A 11: 115,890,831 V1367I probably damaging Het
Nae1 T C 8: 104,523,637 D208G probably benign Het
Nelfe T A 17: 34,854,456 V296D probably damaging Het
Npepps A T 11: 97,218,548 V734E probably damaging Het
Ogdh A G 11: 6,349,390 N752S probably damaging Het
Olfr1094 A G 2: 86,829,654 I301V possibly damaging Het
Olfr266 T C 3: 106,822,187 D124G probably damaging Het
Olfr401 A T 11: 74,121,721 Q144L possibly damaging Het
Olfr906 T C 9: 38,488,377 M116T probably benign Het
Otof C A 5: 30,414,544 G171V probably damaging Het
Phtf2 A T 5: 20,801,941 V208D probably damaging Het
Pkn1 T A 8: 83,683,591 T340S probably damaging Het
Plcd4 C T 1: 74,563,594 L668F possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prss50 A T 9: 110,861,299 D170V probably damaging Het
Ptprg T C 14: 12,237,118 V604A probably damaging Het
Rab33b T C 3: 51,493,405 V100A probably damaging Het
Rbm26 T A 14: 105,131,535 D736V probably damaging Het
Rela C A 19: 5,646,964 P400T probably benign Het
Rpusd4 T C 9: 35,268,038 L50P probably damaging Het
Scn10a A C 9: 119,627,115 Y1214D probably damaging Het
Skint5 T A 4: 113,517,133 D1253V unknown Het
Sp4 G T 12: 118,238,178 P771H probably damaging Het
Sphkap T A 1: 83,278,378 Y263F probably damaging Het
Ssbp1 G A 6: 40,476,753 V78I probably benign Het
St3gal6 A G 16: 58,486,406 I87T probably benign Het
Tango6 T A 8: 106,818,497 D997E probably benign Het
Tpr C T 1: 150,445,888 P2265S possibly damaging Het
Ttc7b A T 12: 100,325,677 F212Y probably damaging Het
Ubc A G 5: 125,388,260 M1T probably null Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Yes1 T C 5: 32,651,686 I132T possibly damaging Het
Ythdc2 A G 18: 44,860,377 T830A probably benign Het
Zbtb41 T A 1: 139,430,306 F451I possibly damaging Het
Zfp995 C T 17: 21,880,512 C247Y probably benign Het
Other mutations in Sema3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Sema3c APN 5 17694860 missense probably damaging 1.00
IGL01528:Sema3c APN 5 17714415 missense probably benign
IGL01618:Sema3c APN 5 17672506 missense probably damaging 1.00
IGL01730:Sema3c APN 5 17711436 missense probably benign 0.01
IGL01762:Sema3c APN 5 17694851 missense possibly damaging 0.81
IGL02049:Sema3c APN 5 17721925 splice site probably benign
IGL02249:Sema3c APN 5 17662963 missense probably damaging 1.00
IGL02657:Sema3c APN 5 17576868 start codon destroyed possibly damaging 0.71
IGL02657:Sema3c APN 5 17662974 missense probably damaging 1.00
IGL03213:Sema3c APN 5 17694639 splice site probably benign
PIT4651001:Sema3c UTSW 5 17694733 missense probably benign 0.37
R0031:Sema3c UTSW 5 17694728 missense probably damaging 1.00
R0558:Sema3c UTSW 5 17714415 missense probably benign 0.00
R0964:Sema3c UTSW 5 17721909 missense probably damaging 1.00
R1164:Sema3c UTSW 5 17678314 missense probably benign 0.40
R1351:Sema3c UTSW 5 17678336 missense possibly damaging 0.60
R1368:Sema3c UTSW 5 17678332 missense possibly damaging 0.96
R1480:Sema3c UTSW 5 17682031 missense possibly damaging 0.57
R1880:Sema3c UTSW 5 17727466 nonsense probably null
R1916:Sema3c UTSW 5 17727401 missense probably benign 0.06
R3934:Sema3c UTSW 5 17681940 missense probably damaging 0.97
R4284:Sema3c UTSW 5 17678347 missense probably benign 0.01
R4449:Sema3c UTSW 5 17576846 start gained probably benign
R4545:Sema3c UTSW 5 17694772 missense probably benign 0.01
R4546:Sema3c UTSW 5 17694772 missense probably benign 0.01
R4660:Sema3c UTSW 5 17672513 missense probably damaging 1.00
R4890:Sema3c UTSW 5 17675159 missense probably benign 0.00
R4937:Sema3c UTSW 5 17694686 missense probably benign 0.01
R5065:Sema3c UTSW 5 17727617 missense possibly damaging 0.89
R5145:Sema3c UTSW 5 17727617 missense possibly damaging 0.89
R5452:Sema3c UTSW 5 17717070 critical splice donor site probably null
R5586:Sema3c UTSW 5 17711424 missense probably damaging 0.99
R5811:Sema3c UTSW 5 17675190 splice site probably null
R5886:Sema3c UTSW 5 17681986 missense possibly damaging 0.90
R6120:Sema3c UTSW 5 17727632 missense probably benign 0.00
R6191:Sema3c UTSW 5 17653806 missense probably damaging 1.00
R6416:Sema3c UTSW 5 17576961 missense probably damaging 0.99
R6441:Sema3c UTSW 5 17724132 missense possibly damaging 0.96
R6816:Sema3c UTSW 5 17670465 missense probably benign 0.36
R7146:Sema3c UTSW 5 17694703 missense probably benign 0.22
R7526:Sema3c UTSW 5 17727596 missense possibly damaging 0.46
R7832:Sema3c UTSW 5 17694847 missense probably damaging 0.99
R8034:Sema3c UTSW 5 17727482 missense probably damaging 1.00
R8053:Sema3c UTSW 5 17655022 missense probably benign 0.00
R8076:Sema3c UTSW 5 17727364 missense probably benign 0.00
Z1176:Sema3c UTSW 5 17727519 missense probably benign 0.04
Z1177:Sema3c UTSW 5 17717031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAGCACTACATCCAAGTTTGTTCC -3'
(R):5'- TCAATTGGAAACGAGTGATGGC -3'

Sequencing Primer
(F):5'- TGAACAAGTAGTTTTTGGATTTGTTC -3'
(R):5'- AGTATAAGTACTCCTGTAAGATCCTG -3'
Posted On2018-04-02