Incidental Mutation 'R6318:Kcnk3'
ID510270
Institutional Source Beutler Lab
Gene Symbol Kcnk3
Ensembl Gene ENSMUSG00000049265
Gene Namepotassium channel, subfamily K, member 3
SynonymscTBAK-1, Task-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R6318 (G1)
Quality Score177.009
Status Validated
Chromosome5
Chromosomal Location30588170-30625271 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30622586 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 327 (C327S)
Ref Sequence ENSEMBL: ENSMUSP00000098987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066295]
Predicted Effect probably damaging
Transcript: ENSMUST00000066295
AA Change: C327S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098987
Gene: ENSMUSG00000049265
AA Change: C327S

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
low complexity region 37 49 N/A INTRINSIC
Pfam:Ion_trans_2 58 134 2.9e-20 PFAM
Pfam:Ion_trans_2 165 248 1.4e-21 PFAM
low complexity region 272 286 N/A INTRINSIC
low complexity region 296 308 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197428
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the superfamily of potassium channel proteins that contain two pore-forming P domains. The encoded protein is an outwardly rectifying channel that is sensitive to changes in extracellular pH and is inhibited by extracellular acidification. Also referred to as an acid-sensitive potassium channel, it is activated by the anesthetics halothane and isoflurane. Although three transcripts are detected in northern blots, there is currently no sequence available to confirm transcript variants for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a null alleles exhibit decreased pH sensitivitive of action potential in serotonergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,393,275 T13A possibly damaging Het
Abcg4 T C 9: 44,275,348 T500A probably benign Het
Adcy4 T A 14: 55,769,224 I1051F probably damaging Het
Adgrg6 A T 10: 14,467,497 N235K probably benign Het
Aldh3a2 A C 11: 61,262,419 Y160* probably null Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Armt1 T C 10: 4,450,859 M202T probably benign Het
AU019823 T C 9: 50,607,461 R284G probably benign Het
Brd2 C A 17: 34,112,898 V349F probably damaging Het
Btnl10 A T 11: 58,926,865 probably benign Het
Ccdc178 A G 18: 22,120,534 V216A possibly damaging Het
Ccdc85c A T 12: 108,274,709 L142Q unknown Het
Cdc27 A T 11: 104,528,694 S172T probably damaging Het
Ceacam14 T C 7: 17,814,312 I109T probably damaging Het
Ces5a C T 8: 93,534,583 G72E probably damaging Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clec14a G A 12: 58,268,215 P207L probably damaging Het
Clec16a G A 16: 10,630,788 R599H probably damaging Het
Csmd1 A T 8: 15,903,212 I3423N probably damaging Het
Cyp4a29 C A 4: 115,250,199 N243K probably benign Het
Ddx59 T C 1: 136,416,872 F94L probably damaging Het
Dusp3 A C 11: 101,986,871 V19G probably benign Het
Fat3 T C 9: 15,916,984 probably benign Het
Fgfr4 T A 13: 55,166,108 V545E probably damaging Het
Fxn G T 19: 24,280,426 A47D probably damaging Het
Gdpgp1 A T 7: 80,239,150 I310F possibly damaging Het
Gm7210 A T 7: 11,594,113 noncoding transcript Het
Grm7 G T 6: 111,358,875 C749F probably damaging Het
Hps4 T G 5: 112,346,629 V26G probably damaging Het
Igf1r A G 7: 68,165,233 D294G probably benign Het
Immp1l T C 2: 105,930,827 F27S probably benign Het
Kif13a T A 13: 46,815,207 probably null Het
Krtap5-4 T C 7: 142,304,090 S166P unknown Het
Lyst G A 13: 13,743,311 D3319N possibly damaging Het
Malrd1 T G 2: 16,042,267 S1735A unknown Het
Myh4 A G 11: 67,243,442 T308A probably benign Het
Myh8 A T 11: 67,299,341 Q1269L probably benign Het
Myo15b G A 11: 115,890,831 V1367I probably damaging Het
Nae1 T C 8: 104,523,637 D208G probably benign Het
Nelfe T A 17: 34,854,456 V296D probably damaging Het
Npepps A T 11: 97,218,548 V734E probably damaging Het
Ogdh A G 11: 6,349,390 N752S probably damaging Het
Olfr1094 A G 2: 86,829,654 I301V possibly damaging Het
Olfr266 T C 3: 106,822,187 D124G probably damaging Het
Olfr401 A T 11: 74,121,721 Q144L possibly damaging Het
Olfr906 T C 9: 38,488,377 M116T probably benign Het
Otof C A 5: 30,414,544 G171V probably damaging Het
Phtf2 A T 5: 20,801,941 V208D probably damaging Het
Pkn1 T A 8: 83,683,591 T340S probably damaging Het
Plcd4 C T 1: 74,563,594 L668F possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prss50 A T 9: 110,861,299 D170V probably damaging Het
Ptprg T C 14: 12,237,118 V604A probably damaging Het
Rab33b T C 3: 51,493,405 V100A probably damaging Het
Rbm26 T A 14: 105,131,535 D736V probably damaging Het
Rela C A 19: 5,646,964 P400T probably benign Het
Rpusd4 T C 9: 35,268,038 L50P probably damaging Het
Scn10a A C 9: 119,627,115 Y1214D probably damaging Het
Sema3c A G 5: 17,672,432 E179G probably damaging Het
Skint5 T A 4: 113,517,133 D1253V unknown Het
Sp4 G T 12: 118,238,178 P771H probably damaging Het
Sphkap T A 1: 83,278,378 Y263F probably damaging Het
Ssbp1 G A 6: 40,476,753 V78I probably benign Het
St3gal6 A G 16: 58,486,406 I87T probably benign Het
Tango6 T A 8: 106,818,497 D997E probably benign Het
Tpr C T 1: 150,445,888 P2265S possibly damaging Het
Ttc7b A T 12: 100,325,677 F212Y probably damaging Het
Ubc A G 5: 125,388,260 M1T probably null Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Yes1 T C 5: 32,651,686 I132T possibly damaging Het
Ythdc2 A G 18: 44,860,377 T830A probably benign Het
Zbtb41 T A 1: 139,430,306 F451I possibly damaging Het
Zfp995 C T 17: 21,880,512 C247Y probably benign Het
Other mutations in Kcnk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02481:Kcnk3 APN 5 30622383 missense probably damaging 0.99
IGL02719:Kcnk3 APN 5 30621980 missense probably damaging 1.00
PIT4802001:Kcnk3 UTSW 5 30622368 missense probably damaging 1.00
R0288:Kcnk3 UTSW 5 30588420 missense probably benign
R0834:Kcnk3 UTSW 5 30622635 missense probably damaging 1.00
R1740:Kcnk3 UTSW 5 30621977 missense possibly damaging 0.95
R2656:Kcnk3 UTSW 5 30622671 missense possibly damaging 0.55
R2923:Kcnk3 UTSW 5 30622070 missense probably damaging 1.00
R3740:Kcnk3 UTSW 5 30621930 missense possibly damaging 0.93
R4584:Kcnk3 UTSW 5 30588386 missense probably damaging 0.99
R5010:Kcnk3 UTSW 5 30622805 missense possibly damaging 0.79
R5070:Kcnk3 UTSW 5 30622386 missense possibly damaging 0.77
R5427:Kcnk3 UTSW 5 30622295 missense possibly damaging 0.86
R5669:Kcnk3 UTSW 5 30622349 missense probably damaging 0.99
R5956:Kcnk3 UTSW 5 30588510 missense probably damaging 1.00
R5982:Kcnk3 UTSW 5 30622670 missense probably benign 0.18
R5986:Kcnk3 UTSW 5 30588378 missense possibly damaging 0.68
R6860:Kcnk3 UTSW 5 30622053 missense possibly damaging 0.86
R6919:Kcnk3 UTSW 5 30622400 missense probably benign 0.00
R7350:Kcnk3 UTSW 5 30621966 missense probably damaging 1.00
R7418:Kcnk3 UTSW 5 30622331 missense possibly damaging 0.57
R7502:Kcnk3 UTSW 5 30622718 missense possibly damaging 0.85
Z1177:Kcnk3 UTSW 5 30588274 start gained probably benign
Z1177:Kcnk3 UTSW 5 30622493 missense probably benign
Z1177:Kcnk3 UTSW 5 30622704 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCTGCGATTCATGACCATG -3'
(R):5'- CACAGTTGGAGATTTAGGGGC -3'

Sequencing Primer
(F):5'- TCATGACCATGAACGCCGAGG -3'
(R):5'- AGCTCCTGCGCTTCATGAG -3'
Posted On2018-04-02