Incidental Mutation 'R6318:Ubc'
ID510273
Institutional Source Beutler Lab
Gene Symbol Ubc
Ensembl Gene ENSMUSG00000008348
Gene Nameubiquitin C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6318 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location125385965-125390202 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 125388260 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000104347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100700] [ENSMUST00000108707] [ENSMUST00000136312] [ENSMUST00000156249]
Predicted Effect probably benign
Transcript: ENSMUST00000100700
SMART Domains Protein: ENSMUSP00000098265
Gene: ENSMUSG00000072612

DomainStartEndE-ValueType
low complexity region 34 71 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 125 144 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108707
AA Change: M1T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104347
Gene: ENSMUSG00000008348
AA Change: M1T

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
UBQ 77 148 2.14e-36 SMART
UBQ 153 201 1.42e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000136312
AA Change: M1T

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114180
Gene: ENSMUSG00000008348
AA Change: M1T

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
UBQ 77 148 2.14e-36 SMART
UBQ 153 224 2.14e-36 SMART
UBQ 229 300 2.14e-36 SMART
UBQ 305 376 2.14e-36 SMART
UBQ 381 452 2.14e-36 SMART
UBQ 457 528 2.14e-36 SMART
UBQ 533 604 2.14e-36 SMART
UBQ 609 680 2.14e-36 SMART
PDB:4MDK|H 684 711 9e-6 PDB
Predicted Effect probably null
Transcript: ENSMUST00000156249
AA Change: M1T

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115578
Gene: ENSMUSG00000008348
AA Change: M1T

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
UBQ 77 148 2.14e-36 SMART
UBQ 153 224 2.14e-36 SMART
UBQ 229 300 2.14e-36 SMART
UBQ 305 376 2.14e-36 SMART
UBQ 381 452 2.14e-36 SMART
UBQ 457 528 2.14e-36 SMART
UBQ 533 604 2.14e-36 SMART
UBQ 609 680 2.14e-36 SMART
PDB:4MDK|H 684 711 9e-6 PDB
Meta Mutation Damage Score 0.9749 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a ubiquitin gene, ubiquitin C. The encoded protein is a polyubiquitin precursor. Conjugation of ubiquitin monomers or polymers can lead to various effects within a cell, depending on the residues to which ubiquitin is conjugated. Ubiquitination has been associated with protein degradation, DNA repair, cell cycle regulation, kinase modification, endocytosis, and regulation of other cell signaling pathways. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygous null embryos die between E 12.5 and E14.5 most likely due to a severe defect in liver cell proliferation. Mutant MEFs exhibit reduced growth rates, premature senescence, increased apoptosis and delayed cell-cycle progression, and are hypersensitive to proteasome inhibitors and heat shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,393,275 T13A possibly damaging Het
Abcg4 T C 9: 44,275,348 T500A probably benign Het
Adcy4 T A 14: 55,769,224 I1051F probably damaging Het
Adgrg6 A T 10: 14,467,497 N235K probably benign Het
Aldh3a2 A C 11: 61,262,419 Y160* probably null Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Armt1 T C 10: 4,450,859 M202T probably benign Het
AU019823 T C 9: 50,607,461 R284G probably benign Het
Brd2 C A 17: 34,112,898 V349F probably damaging Het
Btnl10 A T 11: 58,926,865 probably benign Het
Ccdc178 A G 18: 22,120,534 V216A possibly damaging Het
Ccdc85c A T 12: 108,274,709 L142Q unknown Het
Cdc27 A T 11: 104,528,694 S172T probably damaging Het
Ceacam14 T C 7: 17,814,312 I109T probably damaging Het
Ces5a C T 8: 93,534,583 G72E probably damaging Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clec14a G A 12: 58,268,215 P207L probably damaging Het
Clec16a G A 16: 10,630,788 R599H probably damaging Het
Csmd1 A T 8: 15,903,212 I3423N probably damaging Het
Cyp4a29 C A 4: 115,250,199 N243K probably benign Het
Ddx59 T C 1: 136,416,872 F94L probably damaging Het
Dusp3 A C 11: 101,986,871 V19G probably benign Het
Fat3 T C 9: 15,916,984 probably benign Het
Fgfr4 T A 13: 55,166,108 V545E probably damaging Het
Fxn G T 19: 24,280,426 A47D probably damaging Het
Gdpgp1 A T 7: 80,239,150 I310F possibly damaging Het
Gm7210 A T 7: 11,594,113 noncoding transcript Het
Grm7 G T 6: 111,358,875 C749F probably damaging Het
Hps4 T G 5: 112,346,629 V26G probably damaging Het
Igf1r A G 7: 68,165,233 D294G probably benign Het
Immp1l T C 2: 105,930,827 F27S probably benign Het
Kcnk3 T A 5: 30,622,586 C327S probably damaging Het
Kif13a T A 13: 46,815,207 probably null Het
Krtap5-4 T C 7: 142,304,090 S166P unknown Het
Lyst G A 13: 13,743,311 D3319N possibly damaging Het
Malrd1 T G 2: 16,042,267 S1735A unknown Het
Myh4 A G 11: 67,243,442 T308A probably benign Het
Myh8 A T 11: 67,299,341 Q1269L probably benign Het
Myo15b G A 11: 115,890,831 V1367I probably damaging Het
Nae1 T C 8: 104,523,637 D208G probably benign Het
Nelfe T A 17: 34,854,456 V296D probably damaging Het
Npepps A T 11: 97,218,548 V734E probably damaging Het
Ogdh A G 11: 6,349,390 N752S probably damaging Het
Olfr1094 A G 2: 86,829,654 I301V possibly damaging Het
Olfr266 T C 3: 106,822,187 D124G probably damaging Het
Olfr401 A T 11: 74,121,721 Q144L possibly damaging Het
Olfr906 T C 9: 38,488,377 M116T probably benign Het
Otof C A 5: 30,414,544 G171V probably damaging Het
Phtf2 A T 5: 20,801,941 V208D probably damaging Het
Pkn1 T A 8: 83,683,591 T340S probably damaging Het
Plcd4 C T 1: 74,563,594 L668F possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prss50 A T 9: 110,861,299 D170V probably damaging Het
Ptprg T C 14: 12,237,118 V604A probably damaging Het
Rab33b T C 3: 51,493,405 V100A probably damaging Het
Rbm26 T A 14: 105,131,535 D736V probably damaging Het
Rela C A 19: 5,646,964 P400T probably benign Het
Rpusd4 T C 9: 35,268,038 L50P probably damaging Het
Scn10a A C 9: 119,627,115 Y1214D probably damaging Het
Sema3c A G 5: 17,672,432 E179G probably damaging Het
Skint5 T A 4: 113,517,133 D1253V unknown Het
Sp4 G T 12: 118,238,178 P771H probably damaging Het
Sphkap T A 1: 83,278,378 Y263F probably damaging Het
Ssbp1 G A 6: 40,476,753 V78I probably benign Het
St3gal6 A G 16: 58,486,406 I87T probably benign Het
Tango6 T A 8: 106,818,497 D997E probably benign Het
Tpr C T 1: 150,445,888 P2265S possibly damaging Het
Ttc7b A T 12: 100,325,677 F212Y probably damaging Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Yes1 T C 5: 32,651,686 I132T possibly damaging Het
Ythdc2 A G 18: 44,860,377 T830A probably benign Het
Zbtb41 T A 1: 139,430,306 F451I possibly damaging Het
Zfp995 C T 17: 21,880,512 C247Y probably benign Het
Other mutations in Ubc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02225:Ubc APN 5 125386133 missense probably benign 0.08
IGL02430:Ubc APN 5 125387570 missense probably damaging 1.00
IGL02830:Ubc APN 5 125387313 missense probably damaging 0.97
IGL02866:Ubc APN 5 125387422 missense probably benign
IGL02902:Ubc APN 5 125386229 missense probably benign 0.15
IGL02927:Ubc APN 5 125386137 missense probably benign 0.01
IGL03027:Ubc APN 5 125387501 missense probably damaging 1.00
IGL03066:Ubc APN 5 125388263 splice site probably benign
R4940:Ubc UTSW 5 125386229 missense probably benign 0.15
R5509:Ubc UTSW 5 125387275 missense probably benign 0.30
R6339:Ubc UTSW 5 125387342 missense probably damaging 0.99
R7033:Ubc UTSW 5 125388174 missense probably damaging 1.00
R7764:Ubc UTSW 5 125388069 missense possibly damaging 0.78
R8097:Ubc UTSW 5 125389918 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AAGATCTGCATGCCACCTCTG -3'
(R):5'- ACCATGCCGAGGTTTCTTAAC -3'

Sequencing Primer
(F):5'- ACCTCTGAGGCGAAGGAC -3'
(R):5'- CCGAGGTTTCTTAACTTTGTTAGTC -3'
Posted On2018-04-02