Mutagenetix > Incidental Mutation

Incidental Mutation 'R6318:Igf1r'

510278

Institutional Source

Beutler Lab

Gene Symbol

Igf1r

Ensembl Gene

ENSMUSG00000005533

Gene Name

insulin-like growth factor I receptor

Synonyms

line 186, A330103N21Rik, CD221, hyft, IGF-1R

MMRRC Submission

044473-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6318 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

67952827-68233668 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 68165233 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 294 (D294G)

Ref Sequence

ENSEMBL: ENSMUSP00000005671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005671]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000005671
AA Change: D294G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: D294G

Domain	Start	End	E-Value	Type
Pfam:Recep_L_domain	51	161	1.6e-29	PFAM
FU	227	270	2.98e-12	SMART
Pfam:Recep_L_domain	353	467	3.8e-32	PFAM
FN3	490	593	4.67e-2	SMART
FN3	612	815	1.95e-4	SMART
FN3	833	915	7.4e-5	SMART
low complexity region	937	954	N/A	INTRINSIC
TyrKc	1000	1268	8.51e-141	SMART
low complexity region	1285	1303	N/A	INTRINSIC
low complexity region	1306	1319	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207621

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 97.3%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700102P08Rik	A	G	9: 108,393,275	T13A	possibly damaging	Het
Abcg4	T	C	9: 44,275,348	T500A	probably benign	Het
Adcy4	T	A	14: 55,769,224	I1051F	probably damaging	Het
Adgrg6	A	T	10: 14,467,497	N235K	probably benign	Het
Aldh3a2	A	C	11: 61,262,419	Y160*	probably null	Het
Arhgef4	G	A	1: 34,723,477	A605T	unknown	Het
Armt1	T	C	10: 4,450,859	M202T	probably benign	Het
AU019823	T	C	9: 50,607,461	R284G	probably benign	Het
Brd2	C	A	17: 34,112,898	V349F	probably damaging	Het
Btnl10	A	T	11: 58,926,865		probably benign	Het
Ccdc178	A	G	18: 22,120,534	V216A	possibly damaging	Het
Ccdc85c	A	T	12: 108,274,709	L142Q	unknown	Het
Cdc27	A	T	11: 104,528,694	S172T	probably damaging	Het
Ceacam14	T	C	7: 17,814,312	I109T	probably damaging	Het
Ces5a	C	T	8: 93,534,583	G72E	probably damaging	Het
Cfb	A	G	17: 34,861,824	Y66H	possibly damaging	Het
Clec14a	G	A	12: 58,268,215	P207L	probably damaging	Het
Clec16a	G	A	16: 10,630,788	R599H	probably damaging	Het
Csmd1	A	T	8: 15,903,212	I3423N	probably damaging	Het
Cyp4a29	C	A	4: 115,250,199	N243K	probably benign	Het
Ddx59	T	C	1: 136,416,872	F94L	probably damaging	Het
Dusp3	A	C	11: 101,986,871	V19G	probably benign	Het
Fat3	T	C	9: 15,916,984		probably benign	Het
Fgfr4	T	A	13: 55,166,108	V545E	probably damaging	Het
Fxn	G	T	19: 24,280,426	A47D	probably damaging	Het
Gdpgp1	A	T	7: 80,239,150	I310F	possibly damaging	Het
Gm7210	A	T	7: 11,594,113		noncoding transcript	Het
Grm7	G	T	6: 111,358,875	C749F	probably damaging	Het
Hps4	T	G	5: 112,346,629	V26G	probably damaging	Het
Immp1l	T	C	2: 105,930,827	F27S	probably benign	Het
Kcnk3	T	A	5: 30,622,586	C327S	probably damaging	Het
Kif13a	T	A	13: 46,815,207		probably null	Het
Krtap5-4	T	C	7: 142,304,090	S166P	unknown	Het
Lyst	G	A	13: 13,743,311	D3319N	possibly damaging	Het
Malrd1	T	G	2: 16,042,267	S1735A	unknown	Het
Myh4	A	G	11: 67,243,442	T308A	probably benign	Het
Myh8	A	T	11: 67,299,341	Q1269L	probably benign	Het
Myo15b	G	A	11: 115,890,831	V1367I	probably damaging	Het
Nae1	T	C	8: 104,523,637	D208G	probably benign	Het
Nelfe	T	A	17: 34,854,456	V296D	probably damaging	Het
Npepps	A	T	11: 97,218,548	V734E	probably damaging	Het
Ogdh	A	G	11: 6,349,390	N752S	probably damaging	Het
Olfr1094	A	G	2: 86,829,654	I301V	possibly damaging	Het
Olfr266	T	C	3: 106,822,187	D124G	probably damaging	Het
Olfr401	A	T	11: 74,121,721	Q144L	possibly damaging	Het
Olfr906	T	C	9: 38,488,377	M116T	probably benign	Het
Otof	C	A	5: 30,414,544	G171V	probably damaging	Het
Phtf2	A	T	5: 20,801,941	V208D	probably damaging	Het
Pkn1	T	A	8: 83,683,591	T340S	probably damaging	Het
Plcd4	C	T	1: 74,563,594	L668F	possibly damaging	Het
Plch1	C	T	3: 63,781,390	W131*	probably null	Het
Prss50	A	T	9: 110,861,299	D170V	probably damaging	Het
Ptprg	T	C	14: 12,237,118	V604A	probably damaging	Het
Rab33b	T	C	3: 51,493,405	V100A	probably damaging	Het
Rbm26	T	A	14: 105,131,535	D736V	probably damaging	Het
Rela	C	A	19: 5,646,964	P400T	probably benign	Het
Rpusd4	T	C	9: 35,268,038	L50P	probably damaging	Het
Scn10a	A	C	9: 119,627,115	Y1214D	probably damaging	Het
Sema3c	A	G	5: 17,672,432	E179G	probably damaging	Het
Skint5	T	A	4: 113,517,133	D1253V	unknown	Het
Sp4	G	T	12: 118,238,178	P771H	probably damaging	Het
Sphkap	T	A	1: 83,278,378	Y263F	probably damaging	Het
Ssbp1	G	A	6: 40,476,753	V78I	probably benign	Het
St3gal6	A	G	16: 58,486,406	I87T	probably benign	Het
Tango6	T	A	8: 106,818,497	D997E	probably benign	Het
Tpr	C	T	1: 150,445,888	P2265S	possibly damaging	Het
Ttc7b	A	T	12: 100,325,677	F212Y	probably damaging	Het
Ubc	A	G	5: 125,388,260	M1T	probably null	Het
Vill	G	C	9: 119,063,648	Q376H	probably benign	Het
Yes1	T	C	5: 32,651,686	I132T	possibly damaging	Het
Ythdc2	A	G	18: 44,860,377	T830A	probably benign	Het
Zbtb41	T	A	1: 139,430,306	F451I	possibly damaging	Het
Zfp995	C	T	17: 21,880,512	C247Y	probably benign	Het

Other mutations in Igf1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Igf1r	APN	7	68190023	missense	probably benign
IGL00837:Igf1r	APN	7	68201352	splice site	probably benign
IGL01515:Igf1r	APN	7	68207452	missense	probably damaging	1.00
IGL01572:Igf1r	APN	7	68193441	missense	probably benign	0.01
IGL02100:Igf1r	APN	7	68189958	missense	probably benign	0.05
IGL02506:Igf1r	APN	7	68193396	missense	probably benign
IGL02672:Igf1r	APN	7	68190033	missense	probably benign	0.05
IGL02701:Igf1r	APN	7	68201249	missense	possibly damaging	0.93
IGL02742:Igf1r	APN	7	68189991	missense	possibly damaging	0.94
IGL03073:Igf1r	APN	7	68215043	missense	probably damaging	1.00
IGL03257:Igf1r	APN	7	68214940	missense	probably damaging	1.00
Frufru	UTSW	7	68004163	missense	probably damaging	1.00
Hungarian	UTSW	7	68214997	missense	probably damaging	1.00
Mimi	UTSW	7	68195026	missense	possibly damaging	0.67
Piroshka	UTSW	7	68207336	nonsense	probably null
Romanian	UTSW	7	68004137	missense	possibly damaging	0.94
Sublime	UTSW	7	68004179	missense	probably damaging	1.00
Toy	UTSW	7	68003972	missense	probably damaging	1.00
BB009:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
BB019:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
FR4548:Igf1r	UTSW	7	68226186	small insertion	probably benign
FR4737:Igf1r	UTSW	7	68226181	small insertion	probably benign
FR4976:Igf1r	UTSW	7	68226181	small insertion	probably benign
FR4976:Igf1r	UTSW	7	68226186	small insertion	probably benign
PIT4445001:Igf1r	UTSW	7	68207463	missense	probably damaging	1.00
R0003:Igf1r	UTSW	7	68165242	missense	probably damaging	1.00
R0184:Igf1r	UTSW	7	68226193	missense	possibly damaging	0.84
R0538:Igf1r	UTSW	7	68207826	missense	probably damaging	1.00
R0632:Igf1r	UTSW	7	68165155	missense	probably damaging	1.00
R0727:Igf1r	UTSW	7	68212158	critical splice donor site	probably null
R0750:Igf1r	UTSW	7	68212091	missense	probably damaging	0.99
R1104:Igf1r	UTSW	7	68195026	missense	possibly damaging	0.67
R1169:Igf1r	UTSW	7	68165127	missense	probably benign	0.00
R1348:Igf1r	UTSW	7	68218468	missense	probably damaging	1.00
R1471:Igf1r	UTSW	7	68003837	missense	probably damaging	0.98
R1580:Igf1r	UTSW	7	68207869	missense	probably benign
R1745:Igf1r	UTSW	7	68169913	missense	probably damaging	1.00
R1772:Igf1r	UTSW	7	68195074	missense	probably benign	0.03
R1789:Igf1r	UTSW	7	68214933	nonsense	probably null
R1823:Igf1r	UTSW	7	68194981	missense	possibly damaging	0.77
R1902:Igf1r	UTSW	7	68201249	missense	possibly damaging	0.93
R1962:Igf1r	UTSW	7	68207275	missense	probably damaging	0.99
R2179:Igf1r	UTSW	7	68003950	missense	probably damaging	0.99
R2215:Igf1r	UTSW	7	68165234	missense	probably benign
R2221:Igf1r	UTSW	7	68201962	missense	probably damaging	1.00
R2233:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R2234:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R2235:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R3023:Igf1r	UTSW	7	68183399	missense	probably benign	0.00
R4044:Igf1r	UTSW	7	68190062	missense	possibly damaging	0.83
R4226:Igf1r	UTSW	7	68195078	nonsense	probably null
R4387:Igf1r	UTSW	7	68170009	missense	probably benign
R4388:Igf1r	UTSW	7	68170009	missense	probably benign
R4728:Igf1r	UTSW	7	68189624	missense	probably damaging	1.00
R4781:Igf1r	UTSW	7	68165199	missense	possibly damaging	0.75
R5254:Igf1r	UTSW	7	68207319	missense	probably damaging	0.99
R5278:Igf1r	UTSW	7	68193418	missense	possibly damaging	0.78
R5510:Igf1r	UTSW	7	68193359	missense	probably benign	0.19
R5522:Igf1r	UTSW	7	68183510	missense	probably damaging	0.96
R5527:Igf1r	UTSW	7	68207821	missense	probably damaging	1.00
R5761:Igf1r	UTSW	7	68207253	missense	probably damaging	1.00
R5849:Igf1r	UTSW	7	68190033	missense	probably benign
R6189:Igf1r	UTSW	7	68207336	nonsense	probably null
R6262:Igf1r	UTSW	7	68003972	missense	probably damaging	1.00
R6285:Igf1r	UTSW	7	68004137	missense	possibly damaging	0.94
R6365:Igf1r	UTSW	7	68190050	missense	probably benign	0.26
R6377:Igf1r	UTSW	7	68201250	missense	probably benign	0.00
R6831:Igf1r	UTSW	7	68207319	missense	possibly damaging	0.75
R6848:Igf1r	UTSW	7	68004179	missense	probably damaging	1.00
R6902:Igf1r	UTSW	7	68004163	missense	probably damaging	1.00
R7193:Igf1r	UTSW	7	68187157	missense	probably damaging	1.00
R7373:Igf1r	UTSW	7	68195078	nonsense	probably null
R7442:Igf1r	UTSW	7	68173278	missense	probably damaging	1.00
R7903:Igf1r	UTSW	7	68184752	missense	probably damaging	1.00
R7923:Igf1r	UTSW	7	68190101	missense	probably damaging	1.00
R7932:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
R8368:Igf1r	UTSW	7	68187048	missense	probably benign	0.03
R8458:Igf1r	UTSW	7	68195629	missense	probably benign
R8539:Igf1r	UTSW	7	68003848	missense	probably benign	0.06
R8704:Igf1r	UTSW	7	68170054	splice site	probably benign
R8746:Igf1r	UTSW	7	68214997	missense	probably damaging	1.00
R8829:Igf1r	UTSW	7	68226021	missense	probably damaging	1.00
R8832:Igf1r	UTSW	7	68226021	missense	probably damaging	1.00
R8859:Igf1r	UTSW	7	68183463	missense	possibly damaging	0.75
R9057:Igf1r	UTSW	7	68183438	missense	probably damaging	1.00
R9243:Igf1r	UTSW	7	68212027	missense	probably benign	0.11
R9342:Igf1r	UTSW	7	68194998	missense	probably benign	0.00
R9412:Igf1r	UTSW	7	68207253	missense	probably damaging	1.00
R9525:Igf1r	UTSW	7	68214934	missense	probably damaging	1.00
R9727:Igf1r	UTSW	7	68207806	missense	probably damaging	1.00
R9730:Igf1r	UTSW	7	68189675	missense	probably damaging	1.00
R9779:Igf1r	UTSW	7	68004317	missense	probably damaging	1.00
RF025:Igf1r	UTSW	7	68226179	small insertion	probably benign
RF032:Igf1r	UTSW	7	68226179	small insertion	probably benign
RF034:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF037:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF039:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF044:Igf1r	UTSW	7	68226179	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226168	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226169	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226174	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226180	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226182	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226169	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226170	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226173	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- AGAACAACGAGTGCTGCCAC -3'
(R):5'- GATTCGCATTAAAACAAGCTCAGCC -3'

Sequencing Primer
(F):5'- AGTGCTGCCACCCGGAG -3'
(R):5'- AGCTCAGCCATCACCCTCTG -3'

Posted On

2018-04-02