Mutagenetix > Incidental Mutation

Incidental Mutation 'R6318:Ces5a'

510283

Institutional Source

Beutler Lab

Gene Symbol

Ces5a

Ensembl Gene

ENSMUSG00000058019

Gene Name

carboxylesterase 5A

Synonyms

Ces7, 1700122C07Rik, LOC244598, 1700081L16Rik, cauxin

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R6318 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

93499064-93535830 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 93534583 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 72 (G72E)

Ref Sequence

ENSEMBL: ENSMUSP00000148373 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077816] [ENSMUST00000212009] [ENSMUST00000212722]

AlphaFold

Q6AW46

Predicted Effect

probably damaging
Transcript: ENSMUST00000077816
AA Change: G68E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076988
Gene: ENSMUSG00000058019
AA Change: G68E

Domain	Start	End	E-Value	Type
Pfam:COesterase	10	539	3.2e-157	PFAM
Pfam:Abhydrolase_3	141	238	9.5e-7	PFAM
low complexity region	552	575	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000212009
AA Change: G68E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212722
AA Change: G72E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.7856

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 97.3%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES5, is predominantly expressed in peripheral tissues, including brain, kidney, lung and testis. It encodes a secreted enzyme. Because of high levels in the urine of male domestic cats, this enzyme is also called cauxin (carboxylesterase-like urinary excreted protein). The enzyme functions in regulating the production of a pheromone precursor and may contribute to lipid and cholesterol transfer processes within male reproductive fluids. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700102P08Rik	A	G	9: 108,393,275	T13A	possibly damaging	Het
Abcg4	T	C	9: 44,275,348	T500A	probably benign	Het
Adcy4	T	A	14: 55,769,224	I1051F	probably damaging	Het
Adgrg6	A	T	10: 14,467,497	N235K	probably benign	Het
Aldh3a2	A	C	11: 61,262,419	Y160*	probably null	Het
Arhgef4	G	A	1: 34,723,477	A605T	unknown	Het
Armt1	T	C	10: 4,450,859	M202T	probably benign	Het
AU019823	T	C	9: 50,607,461	R284G	probably benign	Het
Brd2	C	A	17: 34,112,898	V349F	probably damaging	Het
Btnl10	A	T	11: 58,926,865		probably benign	Het
Ccdc178	A	G	18: 22,120,534	V216A	possibly damaging	Het
Ccdc85c	A	T	12: 108,274,709	L142Q	unknown	Het
Cdc27	A	T	11: 104,528,694	S172T	probably damaging	Het
Ceacam14	T	C	7: 17,814,312	I109T	probably damaging	Het
Cfb	A	G	17: 34,861,824	Y66H	possibly damaging	Het
Clec14a	G	A	12: 58,268,215	P207L	probably damaging	Het
Clec16a	G	A	16: 10,630,788	R599H	probably damaging	Het
Csmd1	A	T	8: 15,903,212	I3423N	probably damaging	Het
Cyp4a29	C	A	4: 115,250,199	N243K	probably benign	Het
Ddx59	T	C	1: 136,416,872	F94L	probably damaging	Het
Dusp3	A	C	11: 101,986,871	V19G	probably benign	Het
Fat3	T	C	9: 15,916,984		probably benign	Het
Fgfr4	T	A	13: 55,166,108	V545E	probably damaging	Het
Fxn	G	T	19: 24,280,426	A47D	probably damaging	Het
Gdpgp1	A	T	7: 80,239,150	I310F	possibly damaging	Het
Gm7210	A	T	7: 11,594,113		noncoding transcript	Het
Grm7	G	T	6: 111,358,875	C749F	probably damaging	Het
Hps4	T	G	5: 112,346,629	V26G	probably damaging	Het
Igf1r	A	G	7: 68,165,233	D294G	probably benign	Het
Immp1l	T	C	2: 105,930,827	F27S	probably benign	Het
Kcnk3	T	A	5: 30,622,586	C327S	probably damaging	Het
Kif13a	T	A	13: 46,815,207		probably null	Het
Krtap5-4	T	C	7: 142,304,090	S166P	unknown	Het
Lyst	G	A	13: 13,743,311	D3319N	possibly damaging	Het
Malrd1	T	G	2: 16,042,267	S1735A	unknown	Het
Myh4	A	G	11: 67,243,442	T308A	probably benign	Het
Myh8	A	T	11: 67,299,341	Q1269L	probably benign	Het
Myo15b	G	A	11: 115,890,831	V1367I	probably damaging	Het
Nae1	T	C	8: 104,523,637	D208G	probably benign	Het
Nelfe	T	A	17: 34,854,456	V296D	probably damaging	Het
Npepps	A	T	11: 97,218,548	V734E	probably damaging	Het
Ogdh	A	G	11: 6,349,390	N752S	probably damaging	Het
Olfr1094	A	G	2: 86,829,654	I301V	possibly damaging	Het
Olfr266	T	C	3: 106,822,187	D124G	probably damaging	Het
Olfr401	A	T	11: 74,121,721	Q144L	possibly damaging	Het
Olfr906	T	C	9: 38,488,377	M116T	probably benign	Het
Otof	C	A	5: 30,414,544	G171V	probably damaging	Het
Phtf2	A	T	5: 20,801,941	V208D	probably damaging	Het
Pkn1	T	A	8: 83,683,591	T340S	probably damaging	Het
Plcd4	C	T	1: 74,563,594	L668F	possibly damaging	Het
Plch1	C	T	3: 63,781,390	W131*	probably null	Het
Prss50	A	T	9: 110,861,299	D170V	probably damaging	Het
Ptprg	T	C	14: 12,237,118	V604A	probably damaging	Het
Rab33b	T	C	3: 51,493,405	V100A	probably damaging	Het
Rbm26	T	A	14: 105,131,535	D736V	probably damaging	Het
Rela	C	A	19: 5,646,964	P400T	probably benign	Het
Rpusd4	T	C	9: 35,268,038	L50P	probably damaging	Het
Scn10a	A	C	9: 119,627,115	Y1214D	probably damaging	Het
Sema3c	A	G	5: 17,672,432	E179G	probably damaging	Het
Skint5	T	A	4: 113,517,133	D1253V	unknown	Het
Sp4	G	T	12: 118,238,178	P771H	probably damaging	Het
Sphkap	T	A	1: 83,278,378	Y263F	probably damaging	Het
Ssbp1	G	A	6: 40,476,753	V78I	probably benign	Het
St3gal6	A	G	16: 58,486,406	I87T	probably benign	Het
Tango6	T	A	8: 106,818,497	D997E	probably benign	Het
Tpr	C	T	1: 150,445,888	P2265S	possibly damaging	Het
Ttc7b	A	T	12: 100,325,677	F212Y	probably damaging	Het
Ubc	A	G	5: 125,388,260	M1T	probably null	Het
Vill	G	C	9: 119,063,648	Q376H	probably benign	Het
Yes1	T	C	5: 32,651,686	I132T	possibly damaging	Het
Ythdc2	A	G	18: 44,860,377	T830A	probably benign	Het
Zbtb41	T	A	1: 139,430,306	F451I	possibly damaging	Het
Zfp995	C	T	17: 21,880,512	C247Y	probably benign	Het

Other mutations in Ces5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01069:Ces5a	APN	8	93525544	critical splice donor site	probably null
IGL01520:Ces5a	APN	8	93519578	missense	probably benign	0.08
IGL01674:Ces5a	APN	8	93502219	missense	probably damaging	1.00
IGL02257:Ces5a	APN	8	93525598	missense	probably benign	0.00
IGL02456:Ces5a	APN	8	93528644	splice site	probably benign
IGL03027:Ces5a	APN	8	93523114	splice site	probably null
IGL03051:Ces5a	APN	8	93528598	missense	probably damaging	1.00
IGL03264:Ces5a	APN	8	93502270	missense	possibly damaging	0.74
IGL03290:Ces5a	APN	8	93519632	missense	probably damaging	1.00
R0115:Ces5a	UTSW	8	93502183	missense	probably damaging	0.98
R0124:Ces5a	UTSW	8	93528555	missense	probably damaging	1.00
R0521:Ces5a	UTSW	8	93525658	missense	probably damaging	1.00
R1404:Ces5a	UTSW	8	93502181	missense	probably damaging	1.00
R1404:Ces5a	UTSW	8	93502181	missense	probably damaging	1.00
R1524:Ces5a	UTSW	8	93525665	missense	probably damaging	0.96
R1843:Ces5a	UTSW	8	93514231	missense	probably damaging	1.00
R2029:Ces5a	UTSW	8	93534577	missense	probably damaging	1.00
R2135:Ces5a	UTSW	8	93499741	missense	probably benign	0.33
R2146:Ces5a	UTSW	8	93534699	missense	probably benign	0.03
R2973:Ces5a	UTSW	8	93528504	missense	probably damaging	1.00
R3755:Ces5a	UTSW	8	93528502	missense	probably benign	0.15
R4755:Ces5a	UTSW	8	93535677	missense	probably benign	0.39
R5072:Ces5a	UTSW	8	93534668	missense	probably damaging	1.00
R5278:Ces5a	UTSW	8	93525638	missense	probably damaging	1.00
R5419:Ces5a	UTSW	8	93499431	missense	unknown
R5825:Ces5a	UTSW	8	93525667	missense	probably damaging	1.00
R6925:Ces5a	UTSW	8	93523057	splice site	probably null
R6950:Ces5a	UTSW	8	93530774	missense	probably benign	0.10
R7148:Ces5a	UTSW	8	93502322	missense	probably damaging	1.00
R7256:Ces5a	UTSW	8	93499526	missense	probably benign	0.13
R7290:Ces5a	UTSW	8	93534683	missense	probably damaging	1.00
R7459:Ces5a	UTSW	8	93535741	start gained	probably benign
R7674:Ces5a	UTSW	8	93514269	missense	probably damaging	1.00
R7815:Ces5a	UTSW	8	93520995	missense	possibly damaging	0.79
R8150:Ces5a	UTSW	8	93530802	missense	probably damaging	1.00
R8771:Ces5a	UTSW	8	93528621	missense	possibly damaging	0.85
R9502:Ces5a	UTSW	8	93535680	nonsense	probably null
R9518:Ces5a	UTSW	8	93530802	missense	probably damaging	1.00
R9745:Ces5a	UTSW	8	93502186	missense	probably damaging	0.97
X0024:Ces5a	UTSW	8	93514213	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGAGACAGAAACGCTCAC -3'
(R):5'- AGGCTCCAGTTACTGTACCC -3'

Sequencing Primer
(F):5'- AAACGCTCACCCAGGTCTGTG -3'
(R):5'- TGGAGAAAGAGCCCCTGC -3'

Posted On

2018-04-02