Incidental Mutation 'R6318:Ces5a'
ID510283
Institutional Source Beutler Lab
Gene Symbol Ces5a
Ensembl Gene ENSMUSG00000058019
Gene Namecarboxylesterase 5A
SynonymsCes7, 1700122C07Rik, LOC244598, 1700081L16Rik, cauxin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R6318 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location93499064-93535830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 93534583 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 72 (G72E)
Ref Sequence ENSEMBL: ENSMUSP00000148373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077816] [ENSMUST00000212009] [ENSMUST00000212722]
Predicted Effect probably damaging
Transcript: ENSMUST00000077816
AA Change: G68E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076988
Gene: ENSMUSG00000058019
AA Change: G68E

DomainStartEndE-ValueType
Pfam:COesterase 10 539 3.2e-157 PFAM
Pfam:Abhydrolase_3 141 238 9.5e-7 PFAM
low complexity region 552 575 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212009
AA Change: G68E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212722
AA Change: G72E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7856 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES5, is predominantly expressed in peripheral tissues, including brain, kidney, lung and testis. It encodes a secreted enzyme. Because of high levels in the urine of male domestic cats, this enzyme is also called cauxin (carboxylesterase-like urinary excreted protein). The enzyme functions in regulating the production of a pheromone precursor and may contribute to lipid and cholesterol transfer processes within male reproductive fluids. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,393,275 T13A possibly damaging Het
Abcg4 T C 9: 44,275,348 T500A probably benign Het
Adcy4 T A 14: 55,769,224 I1051F probably damaging Het
Adgrg6 A T 10: 14,467,497 N235K probably benign Het
Aldh3a2 A C 11: 61,262,419 Y160* probably null Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Armt1 T C 10: 4,450,859 M202T probably benign Het
AU019823 T C 9: 50,607,461 R284G probably benign Het
Brd2 C A 17: 34,112,898 V349F probably damaging Het
Btnl10 A T 11: 58,926,865 probably benign Het
Ccdc178 A G 18: 22,120,534 V216A possibly damaging Het
Ccdc85c A T 12: 108,274,709 L142Q unknown Het
Cdc27 A T 11: 104,528,694 S172T probably damaging Het
Ceacam14 T C 7: 17,814,312 I109T probably damaging Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clec14a G A 12: 58,268,215 P207L probably damaging Het
Clec16a G A 16: 10,630,788 R599H probably damaging Het
Csmd1 A T 8: 15,903,212 I3423N probably damaging Het
Cyp4a29 C A 4: 115,250,199 N243K probably benign Het
Ddx59 T C 1: 136,416,872 F94L probably damaging Het
Dusp3 A C 11: 101,986,871 V19G probably benign Het
Fat3 T C 9: 15,916,984 probably benign Het
Fgfr4 T A 13: 55,166,108 V545E probably damaging Het
Fxn G T 19: 24,280,426 A47D probably damaging Het
Gdpgp1 A T 7: 80,239,150 I310F possibly damaging Het
Gm7210 A T 7: 11,594,113 noncoding transcript Het
Grm7 G T 6: 111,358,875 C749F probably damaging Het
Hps4 T G 5: 112,346,629 V26G probably damaging Het
Igf1r A G 7: 68,165,233 D294G probably benign Het
Immp1l T C 2: 105,930,827 F27S probably benign Het
Kcnk3 T A 5: 30,622,586 C327S probably damaging Het
Kif13a T A 13: 46,815,207 probably null Het
Krtap5-4 T C 7: 142,304,090 S166P unknown Het
Lyst G A 13: 13,743,311 D3319N possibly damaging Het
Malrd1 T G 2: 16,042,267 S1735A unknown Het
Myh4 A G 11: 67,243,442 T308A probably benign Het
Myh8 A T 11: 67,299,341 Q1269L probably benign Het
Myo15b G A 11: 115,890,831 V1367I probably damaging Het
Nae1 T C 8: 104,523,637 D208G probably benign Het
Nelfe T A 17: 34,854,456 V296D probably damaging Het
Npepps A T 11: 97,218,548 V734E probably damaging Het
Ogdh A G 11: 6,349,390 N752S probably damaging Het
Olfr1094 A G 2: 86,829,654 I301V possibly damaging Het
Olfr266 T C 3: 106,822,187 D124G probably damaging Het
Olfr401 A T 11: 74,121,721 Q144L possibly damaging Het
Olfr906 T C 9: 38,488,377 M116T probably benign Het
Otof C A 5: 30,414,544 G171V probably damaging Het
Phtf2 A T 5: 20,801,941 V208D probably damaging Het
Pkn1 T A 8: 83,683,591 T340S probably damaging Het
Plcd4 C T 1: 74,563,594 L668F possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prss50 A T 9: 110,861,299 D170V probably damaging Het
Ptprg T C 14: 12,237,118 V604A probably damaging Het
Rab33b T C 3: 51,493,405 V100A probably damaging Het
Rbm26 T A 14: 105,131,535 D736V probably damaging Het
Rela C A 19: 5,646,964 P400T probably benign Het
Rpusd4 T C 9: 35,268,038 L50P probably damaging Het
Scn10a A C 9: 119,627,115 Y1214D probably damaging Het
Sema3c A G 5: 17,672,432 E179G probably damaging Het
Skint5 T A 4: 113,517,133 D1253V unknown Het
Sp4 G T 12: 118,238,178 P771H probably damaging Het
Sphkap T A 1: 83,278,378 Y263F probably damaging Het
Ssbp1 G A 6: 40,476,753 V78I probably benign Het
St3gal6 A G 16: 58,486,406 I87T probably benign Het
Tango6 T A 8: 106,818,497 D997E probably benign Het
Tpr C T 1: 150,445,888 P2265S possibly damaging Het
Ttc7b A T 12: 100,325,677 F212Y probably damaging Het
Ubc A G 5: 125,388,260 M1T probably null Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Yes1 T C 5: 32,651,686 I132T possibly damaging Het
Ythdc2 A G 18: 44,860,377 T830A probably benign Het
Zbtb41 T A 1: 139,430,306 F451I possibly damaging Het
Zfp995 C T 17: 21,880,512 C247Y probably benign Het
Other mutations in Ces5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Ces5a APN 8 93525544 critical splice donor site probably null
IGL01520:Ces5a APN 8 93519578 missense probably benign 0.08
IGL01674:Ces5a APN 8 93502219 missense probably damaging 1.00
IGL02257:Ces5a APN 8 93525598 missense probably benign 0.00
IGL02456:Ces5a APN 8 93528644 splice site probably benign
IGL03027:Ces5a APN 8 93523114 unclassified probably null
IGL03051:Ces5a APN 8 93528598 missense probably damaging 1.00
IGL03264:Ces5a APN 8 93502270 missense possibly damaging 0.74
IGL03290:Ces5a APN 8 93519632 missense probably damaging 1.00
R0115:Ces5a UTSW 8 93502183 missense probably damaging 0.98
R0124:Ces5a UTSW 8 93528555 missense probably damaging 1.00
R0521:Ces5a UTSW 8 93525658 missense probably damaging 1.00
R1404:Ces5a UTSW 8 93502181 missense probably damaging 1.00
R1404:Ces5a UTSW 8 93502181 missense probably damaging 1.00
R1524:Ces5a UTSW 8 93525665 missense probably damaging 0.96
R1843:Ces5a UTSW 8 93514231 missense probably damaging 1.00
R2029:Ces5a UTSW 8 93534577 missense probably damaging 1.00
R2135:Ces5a UTSW 8 93499741 missense probably benign 0.33
R2146:Ces5a UTSW 8 93534699 missense probably benign 0.03
R2973:Ces5a UTSW 8 93528504 missense probably damaging 1.00
R3755:Ces5a UTSW 8 93528502 missense probably benign 0.15
R4755:Ces5a UTSW 8 93535677 missense probably benign 0.39
R5072:Ces5a UTSW 8 93534668 missense probably damaging 1.00
R5278:Ces5a UTSW 8 93525638 missense probably damaging 1.00
R5419:Ces5a UTSW 8 93499431 missense unknown
R5825:Ces5a UTSW 8 93525667 missense probably damaging 1.00
R6925:Ces5a UTSW 8 93523057 intron probably null
R6950:Ces5a UTSW 8 93530774 missense probably benign 0.10
R7148:Ces5a UTSW 8 93502322 missense probably damaging 1.00
R7256:Ces5a UTSW 8 93499526 missense probably benign 0.13
R7290:Ces5a UTSW 8 93534683 missense probably damaging 1.00
R7459:Ces5a UTSW 8 93535741 start gained probably benign
R7674:Ces5a UTSW 8 93514269 missense probably damaging 1.00
R7815:Ces5a UTSW 8 93520995 missense possibly damaging 0.79
R8150:Ces5a UTSW 8 93530802 missense probably damaging 1.00
X0024:Ces5a UTSW 8 93514213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAGACAGAAACGCTCAC -3'
(R):5'- AGGCTCCAGTTACTGTACCC -3'

Sequencing Primer
(F):5'- AAACGCTCACCCAGGTCTGTG -3'
(R):5'- TGGAGAAAGAGCCCCTGC -3'
Posted On2018-04-02