Incidental Mutation 'R6318:Adgrg6'
ID510296
Institutional Source Beutler Lab
Gene Symbol Adgrg6
Ensembl Gene ENSMUSG00000039116
Gene Nameadhesion G protein-coupled receptor G6
SynonymsLOC215798, 1190004A11Rik, DREG, Gpr126
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6318 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location14402583-14545659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14467497 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 235 (N235K)
Ref Sequence ENSEMBL: ENSMUSP00000146821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041168] [ENSMUST00000208429]
Predicted Effect probably benign
Transcript: ENSMUST00000041168
AA Change: N235K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043055
Gene: ENSMUSG00000039116
AA Change: N235K

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CUB 41 149 8.59e-33 SMART
low complexity region 609 620 N/A INTRINSIC
low complexity region 695 706 N/A INTRINSIC
GPS 769 822 2.48e-12 SMART
Pfam:7tm_2 831 1080 4.1e-52 PFAM
low complexity region 1122 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208429
AA Change: N235K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is upregulated in human umbilical vein endothelial cells, encodes a G protein-coupled receptor. Variations in this gene can affect a person's stature. Multiple transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null mutation die during organogenesis and display signs of circulatory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,393,275 T13A possibly damaging Het
Abcg4 T C 9: 44,275,348 T500A probably benign Het
Adcy4 T A 14: 55,769,224 I1051F probably damaging Het
Aldh3a2 A C 11: 61,262,419 Y160* probably null Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Armt1 T C 10: 4,450,859 M202T probably benign Het
AU019823 T C 9: 50,607,461 R284G probably benign Het
Brd2 C A 17: 34,112,898 V349F probably damaging Het
Btnl10 A T 11: 58,926,865 probably benign Het
Ccdc178 A G 18: 22,120,534 V216A possibly damaging Het
Ccdc85c A T 12: 108,274,709 L142Q unknown Het
Cdc27 A T 11: 104,528,694 S172T probably damaging Het
Ceacam14 T C 7: 17,814,312 I109T probably damaging Het
Ces5a C T 8: 93,534,583 G72E probably damaging Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clec14a G A 12: 58,268,215 P207L probably damaging Het
Clec16a G A 16: 10,630,788 R599H probably damaging Het
Csmd1 A T 8: 15,903,212 I3423N probably damaging Het
Cyp4a29 C A 4: 115,250,199 N243K probably benign Het
Ddx59 T C 1: 136,416,872 F94L probably damaging Het
Dusp3 A C 11: 101,986,871 V19G probably benign Het
Fat3 T C 9: 15,916,984 probably benign Het
Fgfr4 T A 13: 55,166,108 V545E probably damaging Het
Fxn G T 19: 24,280,426 A47D probably damaging Het
Gdpgp1 A T 7: 80,239,150 I310F possibly damaging Het
Gm7210 A T 7: 11,594,113 noncoding transcript Het
Grm7 G T 6: 111,358,875 C749F probably damaging Het
Hps4 T G 5: 112,346,629 V26G probably damaging Het
Igf1r A G 7: 68,165,233 D294G probably benign Het
Immp1l T C 2: 105,930,827 F27S probably benign Het
Kcnk3 T A 5: 30,622,586 C327S probably damaging Het
Kif13a T A 13: 46,815,207 probably null Het
Krtap5-4 T C 7: 142,304,090 S166P unknown Het
Lyst G A 13: 13,743,311 D3319N possibly damaging Het
Malrd1 T G 2: 16,042,267 S1735A unknown Het
Myh4 A G 11: 67,243,442 T308A probably benign Het
Myh8 A T 11: 67,299,341 Q1269L probably benign Het
Myo15b G A 11: 115,890,831 V1367I probably damaging Het
Nae1 T C 8: 104,523,637 D208G probably benign Het
Nelfe T A 17: 34,854,456 V296D probably damaging Het
Npepps A T 11: 97,218,548 V734E probably damaging Het
Ogdh A G 11: 6,349,390 N752S probably damaging Het
Olfr1094 A G 2: 86,829,654 I301V possibly damaging Het
Olfr266 T C 3: 106,822,187 D124G probably damaging Het
Olfr401 A T 11: 74,121,721 Q144L possibly damaging Het
Olfr906 T C 9: 38,488,377 M116T probably benign Het
Otof C A 5: 30,414,544 G171V probably damaging Het
Phtf2 A T 5: 20,801,941 V208D probably damaging Het
Pkn1 T A 8: 83,683,591 T340S probably damaging Het
Plcd4 C T 1: 74,563,594 L668F possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prss50 A T 9: 110,861,299 D170V probably damaging Het
Ptprg T C 14: 12,237,118 V604A probably damaging Het
Rab33b T C 3: 51,493,405 V100A probably damaging Het
Rbm26 T A 14: 105,131,535 D736V probably damaging Het
Rela C A 19: 5,646,964 P400T probably benign Het
Rpusd4 T C 9: 35,268,038 L50P probably damaging Het
Scn10a A C 9: 119,627,115 Y1214D probably damaging Het
Sema3c A G 5: 17,672,432 E179G probably damaging Het
Skint5 T A 4: 113,517,133 D1253V unknown Het
Sp4 G T 12: 118,238,178 P771H probably damaging Het
Sphkap T A 1: 83,278,378 Y263F probably damaging Het
Ssbp1 G A 6: 40,476,753 V78I probably benign Het
St3gal6 A G 16: 58,486,406 I87T probably benign Het
Tango6 T A 8: 106,818,497 D997E probably benign Het
Tpr C T 1: 150,445,888 P2265S possibly damaging Het
Ttc7b A T 12: 100,325,677 F212Y probably damaging Het
Ubc A G 5: 125,388,260 M1T probably null Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Yes1 T C 5: 32,651,686 I132T possibly damaging Het
Ythdc2 A G 18: 44,860,377 T830A probably benign Het
Zbtb41 T A 1: 139,430,306 F451I possibly damaging Het
Zfp995 C T 17: 21,880,512 C247Y probably benign Het
Other mutations in Adgrg6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Adgrg6 APN 10 14467450 missense probably damaging 0.99
IGL00428:Adgrg6 APN 10 14467375 missense probably benign
IGL00489:Adgrg6 APN 10 14440403 splice site probably null
IGL00496:Adgrg6 APN 10 14450578 critical splice donor site probably null
IGL00743:Adgrg6 APN 10 14535959 splice site probably benign
IGL01011:Adgrg6 APN 10 14409798 missense probably damaging 0.96
IGL01291:Adgrg6 APN 10 14410530 missense possibly damaging 0.92
IGL01453:Adgrg6 APN 10 14420458 missense possibly damaging 0.94
IGL01594:Adgrg6 APN 10 14434340 missense probably damaging 1.00
IGL02013:Adgrg6 APN 10 14426811 missense probably damaging 0.98
IGL02037:Adgrg6 APN 10 14441441 missense probably damaging 0.98
IGL02070:Adgrg6 APN 10 14467592 missense probably damaging 1.00
IGL02164:Adgrg6 APN 10 14523555 intron probably benign
IGL02262:Adgrg6 APN 10 14441396 missense probably benign 0.00
IGL02272:Adgrg6 APN 10 14468829 missense probably damaging 1.00
IGL02605:Adgrg6 APN 10 14467232 missense probably damaging 1.00
IGL02800:Adgrg6 APN 10 14420605 missense probably damaging 1.00
IGL03175:Adgrg6 APN 10 14439758 missense probably benign 0.04
ANU05:Adgrg6 UTSW 10 14410530 missense possibly damaging 0.92
R0245:Adgrg6 UTSW 10 14458066 splice site probably benign
R0356:Adgrg6 UTSW 10 14426898 missense possibly damaging 0.47
R0388:Adgrg6 UTSW 10 14450658 missense probably benign 0.00
R0508:Adgrg6 UTSW 10 14450616 missense probably benign 0.32
R0626:Adgrg6 UTSW 10 14436884 missense probably damaging 1.00
R1116:Adgrg6 UTSW 10 14438428 missense probably benign 0.00
R1205:Adgrg6 UTSW 10 14434339 missense probably damaging 1.00
R1438:Adgrg6 UTSW 10 14468841 missense possibly damaging 0.68
R1599:Adgrg6 UTSW 10 14467313 nonsense probably null
R1714:Adgrg6 UTSW 10 14439770 missense possibly damaging 0.64
R1728:Adgrg6 UTSW 10 14439782 missense probably damaging 1.00
R1729:Adgrg6 UTSW 10 14439782 missense probably damaging 1.00
R1784:Adgrg6 UTSW 10 14439782 missense probably damaging 1.00
R2124:Adgrg6 UTSW 10 14467186 missense probably damaging 0.98
R2906:Adgrg6 UTSW 10 14432950 missense probably benign 0.03
R3410:Adgrg6 UTSW 10 14440370 missense probably benign 0.10
R3982:Adgrg6 UTSW 10 14448845 missense probably benign 0.10
R4376:Adgrg6 UTSW 10 14438494 missense probably benign 0.02
R4376:Adgrg6 UTSW 10 14469050 missense probably damaging 1.00
R4445:Adgrg6 UTSW 10 14409763 missense probably damaging 1.00
R4446:Adgrg6 UTSW 10 14409763 missense probably damaging 1.00
R4472:Adgrg6 UTSW 10 14436781 missense probably damaging 1.00
R4622:Adgrg6 UTSW 10 14441499 missense probably damaging 1.00
R4623:Adgrg6 UTSW 10 14441499 missense probably damaging 1.00
R4649:Adgrg6 UTSW 10 14468827 missense probably damaging 1.00
R4882:Adgrg6 UTSW 10 14434337 missense possibly damaging 0.88
R4978:Adgrg6 UTSW 10 14420461 missense probably damaging 1.00
R5246:Adgrg6 UTSW 10 14426765 missense probably damaging 1.00
R5420:Adgrg6 UTSW 10 14426986 nonsense probably null
R5461:Adgrg6 UTSW 10 14420504 missense probably damaging 1.00
R5580:Adgrg6 UTSW 10 14410484 nonsense probably null
R5644:Adgrg6 UTSW 10 14432934 missense probably damaging 1.00
R5847:Adgrg6 UTSW 10 14426777 missense probably damaging 1.00
R5900:Adgrg6 UTSW 10 14438419 critical splice donor site probably null
R6302:Adgrg6 UTSW 10 14441483 missense probably benign 0.22
R6319:Adgrg6 UTSW 10 14431622 missense probably damaging 1.00
R6339:Adgrg6 UTSW 10 14434347 missense probably damaging 1.00
R6683:Adgrg6 UTSW 10 14456167 missense probably damaging 0.97
R6983:Adgrg6 UTSW 10 14431695 missense probably damaging 1.00
R7337:Adgrg6 UTSW 10 14467351 missense possibly damaging 0.82
R7378:Adgrg6 UTSW 10 14535892 missense probably benign 0.16
R7463:Adgrg6 UTSW 10 14434396 missense possibly damaging 0.82
R7470:Adgrg6 UTSW 10 14444066 missense probably benign
R7558:Adgrg6 UTSW 10 14431607 missense probably damaging 1.00
R7593:Adgrg6 UTSW 10 14468829 missense probably damaging 1.00
R7747:Adgrg6 UTSW 10 14450577 critical splice donor site probably null
R7768:Adgrg6 UTSW 10 14431666 missense probably benign 0.00
R8049:Adgrg6 UTSW 10 14428199 missense probably benign 0.00
R8059:Adgrg6 UTSW 10 14469050 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCGAAAGTTATAGATGCTGCCC -3'
(R):5'- TGAACTCAAAGCTTTCACGC -3'

Sequencing Primer
(F):5'- TATAGATGCTGCCCCTTAGAGAG -3'
(R):5'- GCTCTGTTTTGAAGCCTCCAAAG -3'
Posted On2018-04-02