Incidental Mutation 'R6318:Ogdh'
ID510297
Institutional Source Beutler Lab
Gene Symbol Ogdh
Ensembl Gene ENSMUSG00000020456
Gene Nameoxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Synonyms2210403E04Rik, alpha-ketoglutarate dehydrogenase, d1401, 2210412K19Rik
MMRRC Submission
Accession Numbers

Genbank: NM_010956; MGI: 1098267; Ensembl: ENSMUST00000093350

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6318 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location6291633-6356642 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6349390 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 752 (N752S)
Ref Sequence ENSEMBL: ENSMUSP00000099090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003461] [ENSMUST00000081894] [ENSMUST00000093350] [ENSMUST00000101554]
Predicted Effect probably damaging
Transcript: ENSMUST00000003461
AA Change: N752S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003461
Gene: ENSMUSG00000020456
AA Change: N752S

DomainStartEndE-ValueType
Blast:Transket_pyr 131 199 8e-13 BLAST
Pfam:E1_dh 256 582 1.4e-95 PFAM
Transket_pyr 651 865 3.44e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081894
AA Change: N748S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080569
Gene: ENSMUSG00000020456
AA Change: N748S

DomainStartEndE-ValueType
Pfam:E1_dh 252 578 1e-96 PFAM
Transket_pyr 647 861 3.44e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000093350
AA Change: N763S

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091041
Gene: ENSMUSG00000020456
AA Change: N763S

DomainStartEndE-ValueType
Pfam:2-oxogl_dehyd_N 47 87 6.6e-21 PFAM
Pfam:E1_dh 267 593 1.1e-101 PFAM
Transket_pyr 662 876 3.44e-50 SMART
Pfam:OxoGdeHyase_C 880 1025 8.7e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101554
AA Change: N752S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099090
Gene: ENSMUSG00000020456
AA Change: N752S

DomainStartEndE-ValueType
Blast:Transket_pyr 131 199 8e-13 BLAST
Pfam:E1_dh 256 582 1.4e-95 PFAM
Transket_pyr 651 865 3.44e-50 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one subunit of the 2-oxoglutarate dehydrogenase complex. This complex catalyzes the overall conversion of 2-oxoglutarate (alpha-ketoglutarate) to succinyl-CoA and CO(2) during the Krebs cycle. The protein is located in the mitochondrial matrix and uses thiamine pyrophosphate as a cofactor. A congenital deficiency in 2-oxoglutarate dehydrogenase activity is believed to lead to hypotonia, metabolic acidosis, and hyperlactatemia. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,393,275 T13A possibly damaging Het
Abcg4 T C 9: 44,275,348 T500A probably benign Het
Adcy4 T A 14: 55,769,224 I1051F probably damaging Het
Adgrg6 A T 10: 14,467,497 N235K probably benign Het
Aldh3a2 A C 11: 61,262,419 Y160* probably null Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Armt1 T C 10: 4,450,859 M202T probably benign Het
AU019823 T C 9: 50,607,461 R284G probably benign Het
Brd2 C A 17: 34,112,898 V349F probably damaging Het
Btnl10 A T 11: 58,926,865 probably benign Het
Ccdc178 A G 18: 22,120,534 V216A possibly damaging Het
Ccdc85c A T 12: 108,274,709 L142Q unknown Het
Cdc27 A T 11: 104,528,694 S172T probably damaging Het
Ceacam14 T C 7: 17,814,312 I109T probably damaging Het
Ces5a C T 8: 93,534,583 G72E probably damaging Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clec14a G A 12: 58,268,215 P207L probably damaging Het
Clec16a G A 16: 10,630,788 R599H probably damaging Het
Csmd1 A T 8: 15,903,212 I3423N probably damaging Het
Cyp4a29 C A 4: 115,250,199 N243K probably benign Het
Ddx59 T C 1: 136,416,872 F94L probably damaging Het
Dusp3 A C 11: 101,986,871 V19G probably benign Het
Fat3 T C 9: 15,916,984 probably benign Het
Fgfr4 T A 13: 55,166,108 V545E probably damaging Het
Fxn G T 19: 24,280,426 A47D probably damaging Het
Gdpgp1 A T 7: 80,239,150 I310F possibly damaging Het
Gm7210 A T 7: 11,594,113 noncoding transcript Het
Grm7 G T 6: 111,358,875 C749F probably damaging Het
Hps4 T G 5: 112,346,629 V26G probably damaging Het
Igf1r A G 7: 68,165,233 D294G probably benign Het
Immp1l T C 2: 105,930,827 F27S probably benign Het
Kcnk3 T A 5: 30,622,586 C327S probably damaging Het
Kif13a T A 13: 46,815,207 probably null Het
Krtap5-4 T C 7: 142,304,090 S166P unknown Het
Lyst G A 13: 13,743,311 D3319N possibly damaging Het
Malrd1 T G 2: 16,042,267 S1735A unknown Het
Myh4 A G 11: 67,243,442 T308A probably benign Het
Myh8 A T 11: 67,299,341 Q1269L probably benign Het
Myo15b G A 11: 115,890,831 V1367I probably damaging Het
Nae1 T C 8: 104,523,637 D208G probably benign Het
Nelfe T A 17: 34,854,456 V296D probably damaging Het
Npepps A T 11: 97,218,548 V734E probably damaging Het
Olfr1094 A G 2: 86,829,654 I301V possibly damaging Het
Olfr266 T C 3: 106,822,187 D124G probably damaging Het
Olfr401 A T 11: 74,121,721 Q144L possibly damaging Het
Olfr906 T C 9: 38,488,377 M116T probably benign Het
Otof C A 5: 30,414,544 G171V probably damaging Het
Phtf2 A T 5: 20,801,941 V208D probably damaging Het
Pkn1 T A 8: 83,683,591 T340S probably damaging Het
Plcd4 C T 1: 74,563,594 L668F possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prss50 A T 9: 110,861,299 D170V probably damaging Het
Ptprg T C 14: 12,237,118 V604A probably damaging Het
Rab33b T C 3: 51,493,405 V100A probably damaging Het
Rbm26 T A 14: 105,131,535 D736V probably damaging Het
Rela C A 19: 5,646,964 P400T probably benign Het
Rpusd4 T C 9: 35,268,038 L50P probably damaging Het
Scn10a A C 9: 119,627,115 Y1214D probably damaging Het
Sema3c A G 5: 17,672,432 E179G probably damaging Het
Skint5 T A 4: 113,517,133 D1253V unknown Het
Sp4 G T 12: 118,238,178 P771H probably damaging Het
Sphkap T A 1: 83,278,378 Y263F probably damaging Het
Ssbp1 G A 6: 40,476,753 V78I probably benign Het
St3gal6 A G 16: 58,486,406 I87T probably benign Het
Tango6 T A 8: 106,818,497 D997E probably benign Het
Tpr C T 1: 150,445,888 P2265S possibly damaging Het
Ttc7b A T 12: 100,325,677 F212Y probably damaging Het
Ubc A G 5: 125,388,260 M1T probably null Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Yes1 T C 5: 32,651,686 I132T possibly damaging Het
Ythdc2 A G 18: 44,860,377 T830A probably benign Het
Zbtb41 T A 1: 139,430,306 F451I possibly damaging Het
Zfp995 C T 17: 21,880,512 C247Y probably benign Het
Other mutations in Ogdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ogdh APN 11 6348790 missense probably damaging 1.00
IGL01503:Ogdh APN 11 6355069 missense probably damaging 1.00
IGL01684:Ogdh APN 11 6342546 missense probably damaging 1.00
IGL02141:Ogdh APN 11 6355015 missense probably damaging 1.00
IGL02313:Ogdh APN 11 6355400 missense probably damaging 0.98
IGL02818:Ogdh APN 11 6348270 missense probably benign
N/A - 535:Ogdh UTSW 11 6324911 missense possibly damaging 0.60
PIT4498001:Ogdh UTSW 11 6340504 missense probably benign 0.09
R0328:Ogdh UTSW 11 6347216 missense probably benign 0.01
R0505:Ogdh UTSW 11 6339936 splice site probably benign
R0627:Ogdh UTSW 11 6347216 missense possibly damaging 0.78
R1119:Ogdh UTSW 11 6340544 missense probably damaging 1.00
R1480:Ogdh UTSW 11 6347827 critical splice acceptor site probably null
R1591:Ogdh UTSW 11 6349384 missense probably damaging 1.00
R1804:Ogdh UTSW 11 6338565 missense probably damaging 1.00
R1873:Ogdh UTSW 11 6340438 splice site probably benign
R1959:Ogdh UTSW 11 6346638 missense possibly damaging 0.49
R2004:Ogdh UTSW 11 6334626 missense possibly damaging 0.90
R2080:Ogdh UTSW 11 6349393 missense probably benign 0.00
R2384:Ogdh UTSW 11 6342526 missense probably damaging 1.00
R2656:Ogdh UTSW 11 6348678 missense probably benign
R2883:Ogdh UTSW 11 6334545 missense probably damaging 1.00
R3405:Ogdh UTSW 11 6349462 missense probably damaging 1.00
R3838:Ogdh UTSW 11 6338627 nonsense probably null
R3933:Ogdh UTSW 11 6342601 missense possibly damaging 0.72
R3939:Ogdh UTSW 11 6350655 nonsense probably null
R4296:Ogdh UTSW 11 6349374 missense probably damaging 0.97
R4393:Ogdh UTSW 11 6316772 missense probably damaging 1.00
R4427:Ogdh UTSW 11 6355421 missense probably benign 0.01
R4667:Ogdh UTSW 11 6340600 missense probably benign 0.20
R4669:Ogdh UTSW 11 6340600 missense probably benign 0.20
R4728:Ogdh UTSW 11 6342549 missense probably damaging 1.00
R4737:Ogdh UTSW 11 6297044 missense probably benign
R4785:Ogdh UTSW 11 6349875 missense probably damaging 1.00
R4796:Ogdh UTSW 11 6340570 missense probably benign 0.01
R5333:Ogdh UTSW 11 6352126 missense probably damaging 1.00
R5592:Ogdh UTSW 11 6316763 intron probably null
R6875:Ogdh UTSW 11 6340477 missense probably benign 0.12
R6988:Ogdh UTSW 11 6313806 nonsense probably null
R7406:Ogdh UTSW 11 6348351 missense probably benign 0.00
R7724:Ogdh UTSW 11 6324887 missense probably benign
R7763:Ogdh UTSW 11 6338558 missense probably benign
R7909:Ogdh UTSW 11 6313965 missense possibly damaging 0.55
R7990:Ogdh UTSW 11 6313965 missense possibly damaging 0.55
R8207:Ogdh UTSW 11 6349329 missense probably benign 0.38
Z1088:Ogdh UTSW 11 6355427 missense probably benign
Z1177:Ogdh UTSW 11 6297051 missense probably benign
Z1177:Ogdh UTSW 11 6316982 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCCCCTTACACTGTATGCAAC -3'
(R):5'- GGACGAATCAAGAGAACCCTCG -3'

Sequencing Primer
(F):5'- AGCTCGCTGTCTGAGTACG -3'
(R):5'- AACCCTCGGCCTTGTTAGGATAG -3'
Posted On2018-04-02