Incidental Mutation 'R6318:Myh8'
ID510301
Institutional Source Beutler Lab
Gene Symbol Myh8
Ensembl Gene ENSMUSG00000055775
Gene Namemyosin, heavy polypeptide 8, skeletal muscle, perinatal
SynonymsMyhsp, 4832426G23Rik, MyHC-pn, Myhs-p
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.841) question?
Stock #R6318 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location67277124-67308634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67299341 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1269 (Q1269L)
Ref Sequence ENSEMBL: ENSMUSP00000019625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019625]
Predicted Effect probably benign
Transcript: ENSMUST00000019625
AA Change: Q1269L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000019625
Gene: ENSMUSG00000055775
AA Change: Q1269L

DomainStartEndE-ValueType
Pfam:Myosin_N 37 76 2.1e-13 PFAM
MYSc 82 782 N/A SMART
IQ 783 805 5.44e-3 SMART
Pfam:Myosin_tail_1 846 1927 2.4e-164 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108686
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer with two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. This gene is located in a cluster of related genes on chromosome 11. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,393,275 T13A possibly damaging Het
Abcg4 T C 9: 44,275,348 T500A probably benign Het
Adcy4 T A 14: 55,769,224 I1051F probably damaging Het
Adgrg6 A T 10: 14,467,497 N235K probably benign Het
Aldh3a2 A C 11: 61,262,419 Y160* probably null Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Armt1 T C 10: 4,450,859 M202T probably benign Het
AU019823 T C 9: 50,607,461 R284G probably benign Het
Brd2 C A 17: 34,112,898 V349F probably damaging Het
Btnl10 A T 11: 58,926,865 probably benign Het
Ccdc178 A G 18: 22,120,534 V216A possibly damaging Het
Ccdc85c A T 12: 108,274,709 L142Q unknown Het
Cdc27 A T 11: 104,528,694 S172T probably damaging Het
Ceacam14 T C 7: 17,814,312 I109T probably damaging Het
Ces5a C T 8: 93,534,583 G72E probably damaging Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clec14a G A 12: 58,268,215 P207L probably damaging Het
Clec16a G A 16: 10,630,788 R599H probably damaging Het
Csmd1 A T 8: 15,903,212 I3423N probably damaging Het
Cyp4a29 C A 4: 115,250,199 N243K probably benign Het
Ddx59 T C 1: 136,416,872 F94L probably damaging Het
Dusp3 A C 11: 101,986,871 V19G probably benign Het
Fat3 T C 9: 15,916,984 probably benign Het
Fgfr4 T A 13: 55,166,108 V545E probably damaging Het
Fxn G T 19: 24,280,426 A47D probably damaging Het
Gdpgp1 A T 7: 80,239,150 I310F possibly damaging Het
Gm7210 A T 7: 11,594,113 noncoding transcript Het
Grm7 G T 6: 111,358,875 C749F probably damaging Het
Hps4 T G 5: 112,346,629 V26G probably damaging Het
Igf1r A G 7: 68,165,233 D294G probably benign Het
Immp1l T C 2: 105,930,827 F27S probably benign Het
Kcnk3 T A 5: 30,622,586 C327S probably damaging Het
Kif13a T A 13: 46,815,207 probably null Het
Krtap5-4 T C 7: 142,304,090 S166P unknown Het
Lyst G A 13: 13,743,311 D3319N possibly damaging Het
Malrd1 T G 2: 16,042,267 S1735A unknown Het
Myh4 A G 11: 67,243,442 T308A probably benign Het
Myo15b G A 11: 115,890,831 V1367I probably damaging Het
Nae1 T C 8: 104,523,637 D208G probably benign Het
Nelfe T A 17: 34,854,456 V296D probably damaging Het
Npepps A T 11: 97,218,548 V734E probably damaging Het
Ogdh A G 11: 6,349,390 N752S probably damaging Het
Olfr1094 A G 2: 86,829,654 I301V possibly damaging Het
Olfr266 T C 3: 106,822,187 D124G probably damaging Het
Olfr401 A T 11: 74,121,721 Q144L possibly damaging Het
Olfr906 T C 9: 38,488,377 M116T probably benign Het
Otof C A 5: 30,414,544 G171V probably damaging Het
Phtf2 A T 5: 20,801,941 V208D probably damaging Het
Pkn1 T A 8: 83,683,591 T340S probably damaging Het
Plcd4 C T 1: 74,563,594 L668F possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prss50 A T 9: 110,861,299 D170V probably damaging Het
Ptprg T C 14: 12,237,118 V604A probably damaging Het
Rab33b T C 3: 51,493,405 V100A probably damaging Het
Rbm26 T A 14: 105,131,535 D736V probably damaging Het
Rela C A 19: 5,646,964 P400T probably benign Het
Rpusd4 T C 9: 35,268,038 L50P probably damaging Het
Scn10a A C 9: 119,627,115 Y1214D probably damaging Het
Sema3c A G 5: 17,672,432 E179G probably damaging Het
Skint5 T A 4: 113,517,133 D1253V unknown Het
Sp4 G T 12: 118,238,178 P771H probably damaging Het
Sphkap T A 1: 83,278,378 Y263F probably damaging Het
Ssbp1 G A 6: 40,476,753 V78I probably benign Het
St3gal6 A G 16: 58,486,406 I87T probably benign Het
Tango6 T A 8: 106,818,497 D997E probably benign Het
Tpr C T 1: 150,445,888 P2265S possibly damaging Het
Ttc7b A T 12: 100,325,677 F212Y probably damaging Het
Ubc A G 5: 125,388,260 M1T probably null Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Yes1 T C 5: 32,651,686 I132T possibly damaging Het
Ythdc2 A G 18: 44,860,377 T830A probably benign Het
Zbtb41 T A 1: 139,430,306 F451I possibly damaging Het
Zfp995 C T 17: 21,880,512 C247Y probably benign Het
Other mutations in Myh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL01020:Myh8 APN 11 67283403 missense probably damaging 0.99
IGL01348:Myh8 APN 11 67297780 missense probably damaging 1.00
IGL01382:Myh8 APN 11 67301973 missense probably damaging 1.00
IGL01454:Myh8 APN 11 67283596 missense probably damaging 1.00
IGL01457:Myh8 APN 11 67292679 missense probably benign 0.00
IGL01472:Myh8 APN 11 67288379 splice site probably benign
IGL01473:Myh8 APN 11 67301825 critical splice donor site probably null
IGL01613:Myh8 APN 11 67301710 missense probably benign 0.11
IGL01763:Myh8 APN 11 67286419 missense probably benign 0.01
IGL01828:Myh8 APN 11 67303826 missense possibly damaging 0.82
IGL01862:Myh8 APN 11 67289694 nonsense probably null
IGL01905:Myh8 APN 11 67284651 missense possibly damaging 0.90
IGL02280:Myh8 APN 11 67283372 unclassified probably benign
IGL02386:Myh8 APN 11 67294440 missense probably damaging 0.99
IGL02449:Myh8 APN 11 67294614 critical splice donor site probably null
IGL02500:Myh8 APN 11 67305710 missense probably benign 0.00
IGL02745:Myh8 APN 11 67297501 missense possibly damaging 0.88
IGL02799:Myh8 APN 11 67301592 splice site probably benign
IGL03063:Myh8 APN 11 67288205 missense probably benign 0.00
IGL03223:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL03336:Myh8 APN 11 67284702 missense probably damaging 1.00
IGL03338:Myh8 APN 11 67298346 missense probably damaging 1.00
IGL03351:Myh8 APN 11 67303913 missense possibly damaging 0.94
IGL03392:Myh8 APN 11 67294418 missense probably damaging 1.00
PIT4354001:Myh8 UTSW 11 67289630 missense probably benign 0.01
R0012:Myh8 UTSW 11 67300021 missense probably benign 0.02
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0115:Myh8 UTSW 11 67306264 splice site probably benign
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0132:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0393:Myh8 UTSW 11 67306017 splice site probably benign
R0453:Myh8 UTSW 11 67292905 missense probably benign 0.03
R0454:Myh8 UTSW 11 67303765 nonsense probably null
R0466:Myh8 UTSW 11 67298579 missense probably benign 0.01
R0487:Myh8 UTSW 11 67302011 missense probably benign
R0511:Myh8 UTSW 11 67284507 missense probably benign 0.01
R0557:Myh8 UTSW 11 67301798 missense possibly damaging 0.88
R0589:Myh8 UTSW 11 67298627 missense probably benign 0.00
R0658:Myh8 UTSW 11 67284532 critical splice donor site probably null
R0782:Myh8 UTSW 11 67289754 missense probably benign 0.16
R0829:Myh8 UTSW 11 67283500 unclassified probably benign
R0845:Myh8 UTSW 11 67286264 missense probably damaging 1.00
R0930:Myh8 UTSW 11 67305998 missense possibly damaging 0.93
R0972:Myh8 UTSW 11 67297759 missense probably damaging 1.00
R1132:Myh8 UTSW 11 67297131 nonsense probably null
R1417:Myh8 UTSW 11 67306185 missense probably damaging 1.00
R1478:Myh8 UTSW 11 67292725 missense probably benign 0.23
R1497:Myh8 UTSW 11 67289812 missense probably benign 0.00
R1605:Myh8 UTSW 11 67301671 missense probably damaging 0.99
R1701:Myh8 UTSW 11 67280138 missense probably damaging 1.00
R1950:Myh8 UTSW 11 67279004 missense possibly damaging 0.75
R1989:Myh8 UTSW 11 67292724 missense probably benign 0.00
R2010:Myh8 UTSW 11 67297164 nonsense probably null
R2095:Myh8 UTSW 11 67286224 missense probably benign 0.00
R2132:Myh8 UTSW 11 67292876 missense probably damaging 1.00
R2152:Myh8 UTSW 11 67294469 missense probably damaging 0.97
R2229:Myh8 UTSW 11 67308348 missense probably damaging 0.98
R2302:Myh8 UTSW 11 67286239 missense probably damaging 1.00
R2364:Myh8 UTSW 11 67294518 missense probably benign 0.03
R2429:Myh8 UTSW 11 67303897 missense probably benign 0.21
R2880:Myh8 UTSW 11 67297264 missense probably damaging 0.97
R3692:Myh8 UTSW 11 67301918 missense probably damaging 0.98
R3756:Myh8 UTSW 11 67284617 unclassified probably benign
R3924:Myh8 UTSW 11 67297137 missense probably damaging 0.99
R4172:Myh8 UTSW 11 67292421 missense probably damaging 1.00
R4255:Myh8 UTSW 11 67299734 missense probably benign
R4621:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4623:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4790:Myh8 UTSW 11 67279963 missense probably damaging 0.99
R4914:Myh8 UTSW 11 67292684 missense probably damaging 1.00
R5074:Myh8 UTSW 11 67305916 missense possibly damaging 0.79
R5119:Myh8 UTSW 11 67298358 missense probably damaging 1.00
R5159:Myh8 UTSW 11 67288353 missense probably damaging 0.99
R5229:Myh8 UTSW 11 67284484 missense probably damaging 0.96
R5320:Myh8 UTSW 11 67286263 missense probably damaging 1.00
R5455:Myh8 UTSW 11 67301418 missense possibly damaging 0.59
R5523:Myh8 UTSW 11 67305962 missense possibly damaging 0.95
R5540:Myh8 UTSW 11 67286440 missense probably benign 0.00
R5726:Myh8 UTSW 11 67294566 missense possibly damaging 0.79
R5770:Myh8 UTSW 11 67297200 missense probably damaging 1.00
R6135:Myh8 UTSW 11 67297500 missense possibly damaging 0.51
R6253:Myh8 UTSW 11 67301967 missense probably benign 0.06
R6432:Myh8 UTSW 11 67298579 missense probably benign 0.01
R6452:Myh8 UTSW 11 67292449 missense probably benign 0.27
R6452:Myh8 UTSW 11 67305739 missense possibly damaging 0.88
R6512:Myh8 UTSW 11 67289662 nonsense probably null
R6714:Myh8 UTSW 11 67306949 missense probably damaging 1.00
R6842:Myh8 UTSW 11 67284655 missense probably damaging 1.00
R7007:Myh8 UTSW 11 67288316 missense probably benign 0.03
R7025:Myh8 UTSW 11 67297539 missense probably benign 0.02
R7086:Myh8 UTSW 11 67292627 splice site probably null
R7098:Myh8 UTSW 11 67279053 missense probably benign 0.03
R7498:Myh8 UTSW 11 67283437 missense possibly damaging 0.80
R7716:Myh8 UTSW 11 67298652 missense possibly damaging 0.51
R7765:Myh8 UTSW 11 67303655 missense probably benign 0.44
R7825:Myh8 UTSW 11 67303712 missense possibly damaging 0.94
R8003:Myh8 UTSW 11 67299760 missense probably damaging 1.00
T0722:Myh8 UTSW 11 67304436 missense probably benign 0.41
Z1088:Myh8 UTSW 11 67298592 missense probably damaging 1.00
Z1176:Myh8 UTSW 11 67303674 missense probably damaging 1.00
Z1177:Myh8 UTSW 11 67301424 missense probably damaging 0.99
Z1177:Myh8 UTSW 11 67308355 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TATGCCAAACACCAACTTTCTG -3'
(R):5'- CCTCAAAAGGTTCTGACAGTCTC -3'

Sequencing Primer
(F):5'- AACACCAACTTTCTGCTTAATATCTC -3'
(R):5'- AAAGGTTCTGACAGTCTCCTGAC -3'
Posted On2018-04-02