Incidental Mutation 'R6318:Npepps'
ID510303
Institutional Source Beutler Lab
Gene Symbol Npepps
Ensembl Gene ENSMUSG00000001441
Gene Nameaminopeptidase puromycin sensitive
SynonymsMP100, Psa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.815) question?
Stock #R6318 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location97205842-97280638 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97218548 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 734 (V734E)
Ref Sequence ENSEMBL: ENSMUSP00000001480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001480] [ENSMUST00000167806] [ENSMUST00000172108]
Predicted Effect probably damaging
Transcript: ENSMUST00000001480
AA Change: V734E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001480
Gene: ENSMUSG00000001441
AA Change: V734E

DomainStartEndE-ValueType
low complexity region 3 45 N/A INTRINSIC
Pfam:Peptidase_M1 54 442 5.2e-155 PFAM
Pfam:ERAP1_C 579 892 7.9e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133907
Predicted Effect unknown
Transcript: ENSMUST00000165216
AA Change: V689E
SMART Domains Protein: ENSMUSP00000128169
Gene: ENSMUSG00000001441
AA Change: V689E

DomainStartEndE-ValueType
low complexity region 4 35 N/A INTRINSIC
Pfam:Peptidase_M1 46 183 1.6e-28 PFAM
Pfam:Peptidase_M1 174 398 2.9e-100 PFAM
Pfam:ERAP1_C 535 848 2.9e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165489
Predicted Effect probably benign
Transcript: ENSMUST00000167806
SMART Domains Protein: ENSMUSP00000130445
Gene: ENSMUSG00000001441

DomainStartEndE-ValueType
low complexity region 3 45 N/A INTRINSIC
Pfam:Peptidase_M1 54 442 3e-153 PFAM
Pfam:Peptidase_MA_2 321 465 7.4e-24 PFAM
Pfam:ERAP1_C 579 632 5.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170506
Predicted Effect possibly damaging
Transcript: ENSMUST00000172108
AA Change: V734E

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127801
Gene: ENSMUSG00000001441
AA Change: V734E

DomainStartEndE-ValueType
low complexity region 3 45 N/A INTRINSIC
Pfam:Peptidase_M1 54 442 6e-153 PFAM
Pfam:Peptidase_MA_2 321 465 1.2e-23 PFAM
Pfam:ERAP1_C 579 859 5.7e-55 PFAM
low complexity region 868 886 N/A INTRINSIC
Meta Mutation Damage Score 0.3592 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the puromycin-sensitive aminopeptidase, a zinc metallopeptidase which hydrolyzes amino acids from the N-terminus of its substrate. The protein has been localized to both the cytoplasm and to cellular membranes. This enzyme degrades enkaphalins in the brain, and studies in mouse suggest that it is involved in proteolytic events regulating the cell cycle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene-trapped mutation exhibit dwarfism, increased anxiety, decreased pain sensitivity, and infertility in both sexes. Females fail to produce the corpus luteum of pregnancy, while males fail to copulate and have impaired spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,393,275 T13A possibly damaging Het
Abcg4 T C 9: 44,275,348 T500A probably benign Het
Adcy4 T A 14: 55,769,224 I1051F probably damaging Het
Adgrg6 A T 10: 14,467,497 N235K probably benign Het
Aldh3a2 A C 11: 61,262,419 Y160* probably null Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Armt1 T C 10: 4,450,859 M202T probably benign Het
AU019823 T C 9: 50,607,461 R284G probably benign Het
Brd2 C A 17: 34,112,898 V349F probably damaging Het
Btnl10 A T 11: 58,926,865 probably benign Het
Ccdc178 A G 18: 22,120,534 V216A possibly damaging Het
Ccdc85c A T 12: 108,274,709 L142Q unknown Het
Cdc27 A T 11: 104,528,694 S172T probably damaging Het
Ceacam14 T C 7: 17,814,312 I109T probably damaging Het
Ces5a C T 8: 93,534,583 G72E probably damaging Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clec14a G A 12: 58,268,215 P207L probably damaging Het
Clec16a G A 16: 10,630,788 R599H probably damaging Het
Csmd1 A T 8: 15,903,212 I3423N probably damaging Het
Cyp4a29 C A 4: 115,250,199 N243K probably benign Het
Ddx59 T C 1: 136,416,872 F94L probably damaging Het
Dusp3 A C 11: 101,986,871 V19G probably benign Het
Fat3 T C 9: 15,916,984 probably benign Het
Fgfr4 T A 13: 55,166,108 V545E probably damaging Het
Fxn G T 19: 24,280,426 A47D probably damaging Het
Gdpgp1 A T 7: 80,239,150 I310F possibly damaging Het
Gm7210 A T 7: 11,594,113 noncoding transcript Het
Grm7 G T 6: 111,358,875 C749F probably damaging Het
Hps4 T G 5: 112,346,629 V26G probably damaging Het
Igf1r A G 7: 68,165,233 D294G probably benign Het
Immp1l T C 2: 105,930,827 F27S probably benign Het
Kcnk3 T A 5: 30,622,586 C327S probably damaging Het
Kif13a T A 13: 46,815,207 probably null Het
Krtap5-4 T C 7: 142,304,090 S166P unknown Het
Lyst G A 13: 13,743,311 D3319N possibly damaging Het
Malrd1 T G 2: 16,042,267 S1735A unknown Het
Myh4 A G 11: 67,243,442 T308A probably benign Het
Myh8 A T 11: 67,299,341 Q1269L probably benign Het
Myo15b G A 11: 115,890,831 V1367I probably damaging Het
Nae1 T C 8: 104,523,637 D208G probably benign Het
Nelfe T A 17: 34,854,456 V296D probably damaging Het
Ogdh A G 11: 6,349,390 N752S probably damaging Het
Olfr1094 A G 2: 86,829,654 I301V possibly damaging Het
Olfr266 T C 3: 106,822,187 D124G probably damaging Het
Olfr401 A T 11: 74,121,721 Q144L possibly damaging Het
Olfr906 T C 9: 38,488,377 M116T probably benign Het
Otof C A 5: 30,414,544 G171V probably damaging Het
Phtf2 A T 5: 20,801,941 V208D probably damaging Het
Pkn1 T A 8: 83,683,591 T340S probably damaging Het
Plcd4 C T 1: 74,563,594 L668F possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prss50 A T 9: 110,861,299 D170V probably damaging Het
Ptprg T C 14: 12,237,118 V604A probably damaging Het
Rab33b T C 3: 51,493,405 V100A probably damaging Het
Rbm26 T A 14: 105,131,535 D736V probably damaging Het
Rela C A 19: 5,646,964 P400T probably benign Het
Rpusd4 T C 9: 35,268,038 L50P probably damaging Het
Scn10a A C 9: 119,627,115 Y1214D probably damaging Het
Sema3c A G 5: 17,672,432 E179G probably damaging Het
Skint5 T A 4: 113,517,133 D1253V unknown Het
Sp4 G T 12: 118,238,178 P771H probably damaging Het
Sphkap T A 1: 83,278,378 Y263F probably damaging Het
Ssbp1 G A 6: 40,476,753 V78I probably benign Het
St3gal6 A G 16: 58,486,406 I87T probably benign Het
Tango6 T A 8: 106,818,497 D997E probably benign Het
Tpr C T 1: 150,445,888 P2265S possibly damaging Het
Ttc7b A T 12: 100,325,677 F212Y probably damaging Het
Ubc A G 5: 125,388,260 M1T probably null Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Yes1 T C 5: 32,651,686 I132T possibly damaging Het
Ythdc2 A G 18: 44,860,377 T830A probably benign Het
Zbtb41 T A 1: 139,430,306 F451I possibly damaging Het
Zfp995 C T 17: 21,880,512 C247Y probably benign Het
Other mutations in Npepps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Npepps APN 11 97236058 splice site probably benign
IGL00904:Npepps APN 11 97258306 missense probably damaging 0.99
IGL00925:Npepps APN 11 97280283 missense probably damaging 0.97
IGL01074:Npepps APN 11 97217811 missense probably damaging 0.98
IGL01869:Npepps APN 11 97236122 missense probably damaging 1.00
IGL01879:Npepps APN 11 97258340 missense possibly damaging 0.66
IGL02145:Npepps APN 11 97218502 splice site probably null
IGL02493:Npepps APN 11 97238159 missense probably damaging 1.00
IGL02561:Npepps APN 11 97229849 nonsense probably null
IGL02957:Npepps APN 11 97242652 missense probably damaging 1.00
IGL03008:Npepps APN 11 97238158 missense probably damaging 1.00
IGL03054:Npepps UTSW 11 97241788 intron probably benign
R0280:Npepps UTSW 11 97241014 missense possibly damaging 0.90
R0743:Npepps UTSW 11 97206058 utr 3 prime probably benign
R0838:Npepps UTSW 11 97267692 splice site probably benign
R1449:Npepps UTSW 11 97207154 missense probably benign 0.01
R1478:Npepps UTSW 11 97226847 missense probably benign 0.03
R1502:Npepps UTSW 11 97218575 missense possibly damaging 0.79
R1726:Npepps UTSW 11 97224669 missense probably damaging 1.00
R2413:Npepps UTSW 11 97240966 missense probably damaging 1.00
R3619:Npepps UTSW 11 97248265 missense possibly damaging 0.90
R4620:Npepps UTSW 11 97238244 missense probably damaging 1.00
R4782:Npepps UTSW 11 97226826 missense probably damaging 1.00
R4810:Npepps UTSW 11 97240933 missense probably damaging 1.00
R4998:Npepps UTSW 11 97206107 intron probably benign
R5086:Npepps UTSW 11 97217799 missense probably benign 0.01
R5289:Npepps UTSW 11 97240927 critical splice donor site probably null
R5740:Npepps UTSW 11 97236068 missense possibly damaging 0.85
R6004:Npepps UTSW 11 97223124 missense probably benign 0.03
R6181:Npepps UTSW 11 97242004 missense probably damaging 0.98
R6213:Npepps UTSW 11 97241997 nonsense probably null
R6244:Npepps UTSW 11 97213790 missense probably damaging 1.00
R6478:Npepps UTSW 11 97258273 critical splice donor site probably null
R6724:Npepps UTSW 11 97206002 utr 3 prime probably benign
R6890:Npepps UTSW 11 97267644 nonsense probably null
R7035:Npepps UTSW 11 97223139 missense probably damaging 0.99
R7426:Npepps UTSW 11 97213156 missense probably benign 0.19
R7749:Npepps UTSW 11 97267628 missense probably benign
R7819:Npepps UTSW 11 97248269 missense probably damaging 1.00
R7885:Npepps UTSW 11 97218648 missense probably damaging 1.00
R8142:Npepps UTSW 11 97218572 missense probably damaging 1.00
R8176:Npepps UTSW 11 97236151 missense probably damaging 1.00
R8237:Npepps UTSW 11 97248200 critical splice donor site probably null
X0021:Npepps UTSW 11 97238120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTACAGTCAGACAGGGTGTG -3'
(R):5'- AGACTTGGTATCACAGTTACAACG -3'

Sequencing Primer
(F):5'- CAGTCAGACAGGGTGTGAGTGTC -3'
(R):5'- CAACGTATGTAACTTGTGCATTATC -3'
Posted On2018-04-02