Incidental Mutation 'R6318:Dusp3'
ID510304
Institutional Source Beutler Lab
Gene Symbol Dusp3
Ensembl Gene ENSMUSG00000003518
Gene Namedual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related)
SynonymsT-DSP11, 5031436O03Rik, 2210015O03Rik, VHR
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6318 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101971143-101987013 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 101986871 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 19 (V19G)
Ref Sequence ENSEMBL: ENSMUSP00000102791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003612] [ENSMUST00000010985] [ENSMUST00000107172] [ENSMUST00000107173] [ENSMUST00000143177] [ENSMUST00000151678] [ENSMUST00000175972] [ENSMUST00000176261] [ENSMUST00000176722]
Predicted Effect probably benign
Transcript: ENSMUST00000003612
SMART Domains Protein: ENSMUSP00000003612
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000010985
SMART Domains Protein: ENSMUSP00000010985
Gene: ENSMUSG00000010841

DomainStartEndE-ValueType
Pfam:KIAA1430 35 130 1.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107172
SMART Domains Protein: ENSMUSP00000102790
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107173
AA Change: V19G

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102791
Gene: ENSMUSG00000003518
AA Change: V19G

DomainStartEndE-ValueType
DSPc 54 201 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143177
SMART Domains Protein: ENSMUSP00000135821
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
PDB:1J4X|A 2 55 1e-22 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000151678
SMART Domains Protein: ENSMUSP00000135384
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 3 108 6.99e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175972
Predicted Effect probably benign
Transcript: ENSMUST00000176261
SMART Domains Protein: ENSMUSP00000135443
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
Pfam:DSPc 37 126 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176722
SMART Domains Protein: ENSMUSP00000134890
Gene: ENSMUSG00000010841

DomainStartEndE-ValueType
Pfam:KIAA1430 1 80 4.8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene maps in a region that contains the BRCA1 locus which confers susceptibility to breast and ovarian cancer. Although DUSP3 is expressed in both breast and ovarian tissues, mutation screening in breast cancer pedigrees and in sporadic tumors was negative, leading to the conclusion that this gene is not BRCA1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased hemoglobin content and angiogenesis in Matrigel plugs and aortic explants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,393,275 T13A possibly damaging Het
Abcg4 T C 9: 44,275,348 T500A probably benign Het
Adcy4 T A 14: 55,769,224 I1051F probably damaging Het
Adgrg6 A T 10: 14,467,497 N235K probably benign Het
Aldh3a2 A C 11: 61,262,419 Y160* probably null Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Armt1 T C 10: 4,450,859 M202T probably benign Het
AU019823 T C 9: 50,607,461 R284G probably benign Het
Brd2 C A 17: 34,112,898 V349F probably damaging Het
Btnl10 A T 11: 58,926,865 probably benign Het
Ccdc178 A G 18: 22,120,534 V216A possibly damaging Het
Ccdc85c A T 12: 108,274,709 L142Q unknown Het
Cdc27 A T 11: 104,528,694 S172T probably damaging Het
Ceacam14 T C 7: 17,814,312 I109T probably damaging Het
Ces5a C T 8: 93,534,583 G72E probably damaging Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clec14a G A 12: 58,268,215 P207L probably damaging Het
Clec16a G A 16: 10,630,788 R599H probably damaging Het
Csmd1 A T 8: 15,903,212 I3423N probably damaging Het
Cyp4a29 C A 4: 115,250,199 N243K probably benign Het
Ddx59 T C 1: 136,416,872 F94L probably damaging Het
Fat3 T C 9: 15,916,984 probably benign Het
Fgfr4 T A 13: 55,166,108 V545E probably damaging Het
Fxn G T 19: 24,280,426 A47D probably damaging Het
Gdpgp1 A T 7: 80,239,150 I310F possibly damaging Het
Gm7210 A T 7: 11,594,113 noncoding transcript Het
Grm7 G T 6: 111,358,875 C749F probably damaging Het
Hps4 T G 5: 112,346,629 V26G probably damaging Het
Igf1r A G 7: 68,165,233 D294G probably benign Het
Immp1l T C 2: 105,930,827 F27S probably benign Het
Kcnk3 T A 5: 30,622,586 C327S probably damaging Het
Kif13a T A 13: 46,815,207 probably null Het
Krtap5-4 T C 7: 142,304,090 S166P unknown Het
Lyst G A 13: 13,743,311 D3319N possibly damaging Het
Malrd1 T G 2: 16,042,267 S1735A unknown Het
Myh4 A G 11: 67,243,442 T308A probably benign Het
Myh8 A T 11: 67,299,341 Q1269L probably benign Het
Myo15b G A 11: 115,890,831 V1367I probably damaging Het
Nae1 T C 8: 104,523,637 D208G probably benign Het
Nelfe T A 17: 34,854,456 V296D probably damaging Het
Npepps A T 11: 97,218,548 V734E probably damaging Het
Ogdh A G 11: 6,349,390 N752S probably damaging Het
Olfr1094 A G 2: 86,829,654 I301V possibly damaging Het
Olfr266 T C 3: 106,822,187 D124G probably damaging Het
Olfr401 A T 11: 74,121,721 Q144L possibly damaging Het
Olfr906 T C 9: 38,488,377 M116T probably benign Het
Otof C A 5: 30,414,544 G171V probably damaging Het
Phtf2 A T 5: 20,801,941 V208D probably damaging Het
Pkn1 T A 8: 83,683,591 T340S probably damaging Het
Plcd4 C T 1: 74,563,594 L668F possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prss50 A T 9: 110,861,299 D170V probably damaging Het
Ptprg T C 14: 12,237,118 V604A probably damaging Het
Rab33b T C 3: 51,493,405 V100A probably damaging Het
Rbm26 T A 14: 105,131,535 D736V probably damaging Het
Rela C A 19: 5,646,964 P400T probably benign Het
Rpusd4 T C 9: 35,268,038 L50P probably damaging Het
Scn10a A C 9: 119,627,115 Y1214D probably damaging Het
Sema3c A G 5: 17,672,432 E179G probably damaging Het
Skint5 T A 4: 113,517,133 D1253V unknown Het
Sp4 G T 12: 118,238,178 P771H probably damaging Het
Sphkap T A 1: 83,278,378 Y263F probably damaging Het
Ssbp1 G A 6: 40,476,753 V78I probably benign Het
St3gal6 A G 16: 58,486,406 I87T probably benign Het
Tango6 T A 8: 106,818,497 D997E probably benign Het
Tpr C T 1: 150,445,888 P2265S possibly damaging Het
Ttc7b A T 12: 100,325,677 F212Y probably damaging Het
Ubc A G 5: 125,388,260 M1T probably null Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Yes1 T C 5: 32,651,686 I132T possibly damaging Het
Ythdc2 A G 18: 44,860,377 T830A probably benign Het
Zbtb41 T A 1: 139,430,306 F451I possibly damaging Het
Zfp995 C T 17: 21,880,512 C247Y probably benign Het
Other mutations in Dusp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Dusp3 APN 11 101984644 missense probably benign 0.37
R0189:Dusp3 UTSW 11 101981721 missense probably damaging 1.00
R0751:Dusp3 UTSW 11 101981728 missense probably benign 0.00
R1771:Dusp3 UTSW 11 101984735 start codon destroyed probably null 0.95
R2220:Dusp3 UTSW 11 101974805 missense probably damaging 1.00
R2762:Dusp3 UTSW 11 101974835 missense probably benign 0.00
R4591:Dusp3 UTSW 11 101973620 utr 3 prime probably benign
R5373:Dusp3 UTSW 11 101984625 missense possibly damaging 0.69
R5374:Dusp3 UTSW 11 101984625 missense possibly damaging 0.69
R6119:Dusp3 UTSW 11 101980669 unclassified probably benign
R6495:Dusp3 UTSW 11 101981827 missense probably benign 0.00
X0020:Dusp3 UTSW 11 101974778 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGAGAGTTAGAGTCCCACCC -3'
(R):5'- CTTAGCTCTCCCCATGACAAG -3'

Sequencing Primer
(F):5'- TGTGAGCCTCTGCCTGTGC -3'
(R):5'- ACAAGGTGTCATAGTTACCCAG -3'
Posted On2018-04-02