Incidental Mutation 'R6318:Sp4'
ID510309
Institutional Source Beutler Lab
Gene Symbol Sp4
Ensembl Gene ENSMUSG00000025323
Gene Nametrans-acting transcription factor 4
Synonyms5730497N03Rik, HF1-b, HF-1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock #R6318 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location118234933-118301440 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 118238178 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 771 (P771H)
Ref Sequence ENSEMBL: ENSMUSP00000026367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026367] [ENSMUST00000222314]
Predicted Effect probably damaging
Transcript: ENSMUST00000026367
AA Change: P771H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026367
Gene: ENSMUSG00000025323
AA Change: P771H

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 120 146 N/A INTRINSIC
internal_repeat_1 157 255 4.15e-6 PROSPERO
internal_repeat_2 203 265 5.92e-5 PROSPERO
low complexity region 272 296 N/A INTRINSIC
low complexity region 300 342 N/A INTRINSIC
low complexity region 364 378 N/A INTRINSIC
low complexity region 392 421 N/A INTRINSIC
low complexity region 424 445 N/A INTRINSIC
internal_repeat_2 451 506 5.92e-5 PROSPERO
internal_repeat_1 461 539 4.15e-6 PROSPERO
low complexity region 540 549 N/A INTRINSIC
low complexity region 556 570 N/A INTRINSIC
low complexity region 595 607 N/A INTRINSIC
low complexity region 629 638 N/A INTRINSIC
ZnF_C2H2 645 669 2.82e0 SMART
ZnF_C2H2 675 699 7.37e-4 SMART
ZnF_C2H2 705 727 1.47e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220671
Predicted Effect probably damaging
Transcript: ENSMUST00000222314
AA Change: P773H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.1691 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that can bind to the GC promoter region of a variety of genes, including those of the photoreceptor signal transduction system. The encoded protein binds to the same sites in promoter CpG islands as does the transcription factor SP1, although its expression is much more restricted compared to that of SP1. This gene may be involved in bipolar disorder and schizophrenia. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac arrhythmias and most die shortly after birth. Surviving males complete spermatogenesis but do not copulate, while females show delayed sexual maturation and reduction in spleen, thymus, and uterus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,393,275 T13A possibly damaging Het
Abcg4 T C 9: 44,275,348 T500A probably benign Het
Adcy4 T A 14: 55,769,224 I1051F probably damaging Het
Adgrg6 A T 10: 14,467,497 N235K probably benign Het
Aldh3a2 A C 11: 61,262,419 Y160* probably null Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Armt1 T C 10: 4,450,859 M202T probably benign Het
AU019823 T C 9: 50,607,461 R284G probably benign Het
Brd2 C A 17: 34,112,898 V349F probably damaging Het
Btnl10 A T 11: 58,926,865 probably benign Het
Ccdc178 A G 18: 22,120,534 V216A possibly damaging Het
Ccdc85c A T 12: 108,274,709 L142Q unknown Het
Cdc27 A T 11: 104,528,694 S172T probably damaging Het
Ceacam14 T C 7: 17,814,312 I109T probably damaging Het
Ces5a C T 8: 93,534,583 G72E probably damaging Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clec14a G A 12: 58,268,215 P207L probably damaging Het
Clec16a G A 16: 10,630,788 R599H probably damaging Het
Csmd1 A T 8: 15,903,212 I3423N probably damaging Het
Cyp4a29 C A 4: 115,250,199 N243K probably benign Het
Ddx59 T C 1: 136,416,872 F94L probably damaging Het
Dusp3 A C 11: 101,986,871 V19G probably benign Het
Fat3 T C 9: 15,916,984 probably benign Het
Fgfr4 T A 13: 55,166,108 V545E probably damaging Het
Fxn G T 19: 24,280,426 A47D probably damaging Het
Gdpgp1 A T 7: 80,239,150 I310F possibly damaging Het
Gm7210 A T 7: 11,594,113 noncoding transcript Het
Grm7 G T 6: 111,358,875 C749F probably damaging Het
Hps4 T G 5: 112,346,629 V26G probably damaging Het
Igf1r A G 7: 68,165,233 D294G probably benign Het
Immp1l T C 2: 105,930,827 F27S probably benign Het
Kcnk3 T A 5: 30,622,586 C327S probably damaging Het
Kif13a T A 13: 46,815,207 probably null Het
Krtap5-4 T C 7: 142,304,090 S166P unknown Het
Lyst G A 13: 13,743,311 D3319N possibly damaging Het
Malrd1 T G 2: 16,042,267 S1735A unknown Het
Myh4 A G 11: 67,243,442 T308A probably benign Het
Myh8 A T 11: 67,299,341 Q1269L probably benign Het
Myo15b G A 11: 115,890,831 V1367I probably damaging Het
Nae1 T C 8: 104,523,637 D208G probably benign Het
Nelfe T A 17: 34,854,456 V296D probably damaging Het
Npepps A T 11: 97,218,548 V734E probably damaging Het
Ogdh A G 11: 6,349,390 N752S probably damaging Het
Olfr1094 A G 2: 86,829,654 I301V possibly damaging Het
Olfr266 T C 3: 106,822,187 D124G probably damaging Het
Olfr401 A T 11: 74,121,721 Q144L possibly damaging Het
Olfr906 T C 9: 38,488,377 M116T probably benign Het
Otof C A 5: 30,414,544 G171V probably damaging Het
Phtf2 A T 5: 20,801,941 V208D probably damaging Het
Pkn1 T A 8: 83,683,591 T340S probably damaging Het
Plcd4 C T 1: 74,563,594 L668F possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prss50 A T 9: 110,861,299 D170V probably damaging Het
Ptprg T C 14: 12,237,118 V604A probably damaging Het
Rab33b T C 3: 51,493,405 V100A probably damaging Het
Rbm26 T A 14: 105,131,535 D736V probably damaging Het
Rela C A 19: 5,646,964 P400T probably benign Het
Rpusd4 T C 9: 35,268,038 L50P probably damaging Het
Scn10a A C 9: 119,627,115 Y1214D probably damaging Het
Sema3c A G 5: 17,672,432 E179G probably damaging Het
Skint5 T A 4: 113,517,133 D1253V unknown Het
Sphkap T A 1: 83,278,378 Y263F probably damaging Het
Ssbp1 G A 6: 40,476,753 V78I probably benign Het
St3gal6 A G 16: 58,486,406 I87T probably benign Het
Tango6 T A 8: 106,818,497 D997E probably benign Het
Tpr C T 1: 150,445,888 P2265S possibly damaging Het
Ttc7b A T 12: 100,325,677 F212Y probably damaging Het
Ubc A G 5: 125,388,260 M1T probably null Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Yes1 T C 5: 32,651,686 I132T possibly damaging Het
Ythdc2 A G 18: 44,860,377 T830A probably benign Het
Zbtb41 T A 1: 139,430,306 F451I possibly damaging Het
Zfp995 C T 17: 21,880,512 C247Y probably benign Het
Other mutations in Sp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02103:Sp4 APN 12 118299549 missense probably damaging 0.99
IGL02817:Sp4 APN 12 118299552 missense probably damaging 1.00
IGL02833:Sp4 APN 12 118261881 missense probably benign 0.05
Deadloss UTSW 12 118254439 missense possibly damaging 0.82
Speck UTSW 12 118300811 splice site probably null
R0128:Sp4 UTSW 12 118300816 splice site probably benign
R0130:Sp4 UTSW 12 118300816 splice site probably benign
R0398:Sp4 UTSW 12 118298673 missense possibly damaging 0.79
R0626:Sp4 UTSW 12 118299579 missense probably damaging 1.00
R1193:Sp4 UTSW 12 118299246 missense possibly damaging 0.94
R1775:Sp4 UTSW 12 118299600 missense probably damaging 0.99
R4724:Sp4 UTSW 12 118261809 missense probably benign
R4861:Sp4 UTSW 12 118300811 splice site probably null
R4861:Sp4 UTSW 12 118300811 splice site probably null
R4969:Sp4 UTSW 12 118299606 missense probably damaging 0.96
R5049:Sp4 UTSW 12 118254472 missense probably benign 0.04
R5178:Sp4 UTSW 12 118261889 missense possibly damaging 0.46
R5208:Sp4 UTSW 12 118299546 missense probably damaging 1.00
R5722:Sp4 UTSW 12 118299241 missense possibly damaging 0.66
R6619:Sp4 UTSW 12 118299342 missense possibly damaging 0.92
R6917:Sp4 UTSW 12 118299173 missense probably damaging 1.00
R7195:Sp4 UTSW 12 118300072 missense possibly damaging 0.92
R7614:Sp4 UTSW 12 118254439 missense possibly damaging 0.82
R7747:Sp4 UTSW 12 118254404 splice site probably null
R7983:Sp4 UTSW 12 118301232 start codon destroyed probably null
R8709:Sp4 UTSW 12 118299454 missense possibly damaging 0.66
R8817:Sp4 UTSW 12 118261889 missense possibly damaging 0.92
Z1177:Sp4 UTSW 12 118300059 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACTTTCTGTGTTGAACCAAAATCCC -3'
(R):5'- AGAGATTTGAATGTCCAGAGTGTTC -3'

Sequencing Primer
(F):5'- TCCCTGGAATACTTAAAGATGCC -3'
(R):5'- AAGGTTTATGCGGAGTGATCACC -3'
Posted On2018-04-02