Incidental Mutation 'R6318:Nelfe'
ID510319
Institutional Source Beutler Lab
Gene Symbol Nelfe
Ensembl Gene ENSMUSG00000024369
Gene Namenegative elongation factor complex member E, Rdbp
SynonymsRdbp, NELF-E
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6318 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34850391-34856372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34854456 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 296 (V296D)
Ref Sequence ENSEMBL: ENSMUSP00000134272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025229] [ENSMUST00000046022] [ENSMUST00000097343] [ENSMUST00000128767] [ENSMUST00000146299] [ENSMUST00000153400] [ENSMUST00000154526] [ENSMUST00000165953] [ENSMUST00000172966] [ENSMUST00000173065] [ENSMUST00000173357] [ENSMUST00000176203]
Predicted Effect probably benign
Transcript: ENSMUST00000025229
SMART Domains Protein: ENSMUSP00000025229
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
CCP 36 88 5.15e-1 SMART
CCP 102 157 4.62e-15 SMART
CCP 164 217 2.06e-12 SMART
VWA 267 472 1.07e-40 SMART
Tryp_SPc 480 751 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046022
SMART Domains Protein: ENSMUSP00000036265
Gene: ENSMUSG00000040356

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 171 176 N/A INTRINSIC
low complexity region 208 237 N/A INTRINSIC
low complexity region 269 279 N/A INTRINSIC
DEXDc 304 487 3.61e-28 SMART
low complexity region 583 592 N/A INTRINSIC
HELICc 619 705 8.63e-17 SMART
Pfam:rRNA_proc-arch 760 1044 9.7e-39 PFAM
DSHCT 1067 1243 7.67e-77 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097343
AA Change: V296D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094956
Gene: ENSMUSG00000024369
AA Change: V296D

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128767
SMART Domains Protein: ENSMUSP00000119977
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
CCP 34 86 5.15e-1 SMART
CCP 100 155 4.62e-15 SMART
CCP 162 215 2.06e-12 SMART
VWA 265 470 1.07e-40 SMART
Tryp_SPc 478 749 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129891
SMART Domains Protein: ENSMUSP00000120864
Gene: ENSMUSG00000092511

DomainStartEndE-ValueType
Blast:VWA 2 77 8e-7 BLAST
Tryp_SPc 85 365 5.69e-8 SMART
CCP 310 365 4.62e-15 SMART
CCP 372 425 2.06e-12 SMART
VWA 475 680 1.07e-40 SMART
Tryp_SPc 688 959 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133127
SMART Domains Protein: ENSMUSP00000118360
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
PDB:2WIN|L 2 43 2e-20 PDB
Blast:VWA 13 44 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141295
SMART Domains Protein: ENSMUSP00000118945
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
Tryp_SPc 18 258 3.76e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146299
SMART Domains Protein: ENSMUSP00000117677
Gene: ENSMUSG00000092511

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
CCP 94 148 1.89e-11 SMART
VWA 103 311 1.74e-1 SMART
Tryp_SPc 315 547 1.49e-7 SMART
CCP 549 601 5.15e-1 SMART
CCP 615 670 4.62e-15 SMART
CCP 677 730 2.06e-12 SMART
VWA 780 985 1.07e-40 SMART
Tryp_SPc 993 1264 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153400
SMART Domains Protein: ENSMUSP00000116497
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
Tryp_SPc 1 217 2.36e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154526
SMART Domains Protein: ENSMUSP00000120990
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
CCP 34 86 5.15e-1 SMART
CCP 100 155 4.62e-15 SMART
CCP 162 215 2.06e-12 SMART
VWA 265 470 1.07e-40 SMART
Tryp_SPc 478 711 5.03e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165953
AA Change: V296D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131195
Gene: ENSMUSG00000024369
AA Change: V296D

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172966
Predicted Effect probably benign
Transcript: ENSMUST00000173065
SMART Domains Protein: ENSMUSP00000133934
Gene: ENSMUSG00000024369

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 228 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173357
AA Change: V296D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134272
Gene: ENSMUSG00000024369
AA Change: V296D

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174888
Predicted Effect probably benign
Transcript: ENSMUST00000176203
SMART Domains Protein: ENSMUSP00000135660
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
CCP 36 88 5.15e-1 SMART
CCP 102 157 4.62e-15 SMART
CCP 164 217 2.06e-12 SMART
VWA 267 472 1.07e-40 SMART
Tryp_SPc 480 713 5.03e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a complex termed negative elongation factor (NELF) which represses RNA polymerase II transcript elongation. This protein bears similarity to nuclear RNA-binding proteins; however, it has not been demonstrated that this protein binds RNA. The protein contains a tract of alternating basic and acidic residues, largely arginine (R) and aspartic acid (D). The gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,393,275 T13A possibly damaging Het
Abcg4 T C 9: 44,275,348 T500A probably benign Het
Adcy4 T A 14: 55,769,224 I1051F probably damaging Het
Adgrg6 A T 10: 14,467,497 N235K probably benign Het
Aldh3a2 A C 11: 61,262,419 Y160* probably null Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Armt1 T C 10: 4,450,859 M202T probably benign Het
AU019823 T C 9: 50,607,461 R284G probably benign Het
Brd2 C A 17: 34,112,898 V349F probably damaging Het
Btnl10 A T 11: 58,926,865 probably benign Het
Ccdc178 A G 18: 22,120,534 V216A possibly damaging Het
Ccdc85c A T 12: 108,274,709 L142Q unknown Het
Cdc27 A T 11: 104,528,694 S172T probably damaging Het
Ceacam14 T C 7: 17,814,312 I109T probably damaging Het
Ces5a C T 8: 93,534,583 G72E probably damaging Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clec14a G A 12: 58,268,215 P207L probably damaging Het
Clec16a G A 16: 10,630,788 R599H probably damaging Het
Csmd1 A T 8: 15,903,212 I3423N probably damaging Het
Cyp4a29 C A 4: 115,250,199 N243K probably benign Het
Ddx59 T C 1: 136,416,872 F94L probably damaging Het
Dusp3 A C 11: 101,986,871 V19G probably benign Het
Fat3 T C 9: 15,916,984 probably benign Het
Fgfr4 T A 13: 55,166,108 V545E probably damaging Het
Fxn G T 19: 24,280,426 A47D probably damaging Het
Gdpgp1 A T 7: 80,239,150 I310F possibly damaging Het
Gm7210 A T 7: 11,594,113 noncoding transcript Het
Grm7 G T 6: 111,358,875 C749F probably damaging Het
Hps4 T G 5: 112,346,629 V26G probably damaging Het
Igf1r A G 7: 68,165,233 D294G probably benign Het
Immp1l T C 2: 105,930,827 F27S probably benign Het
Kcnk3 T A 5: 30,622,586 C327S probably damaging Het
Kif13a T A 13: 46,815,207 probably null Het
Krtap5-4 T C 7: 142,304,090 S166P unknown Het
Lyst G A 13: 13,743,311 D3319N possibly damaging Het
Malrd1 T G 2: 16,042,267 S1735A unknown Het
Myh4 A G 11: 67,243,442 T308A probably benign Het
Myh8 A T 11: 67,299,341 Q1269L probably benign Het
Myo15b G A 11: 115,890,831 V1367I probably damaging Het
Nae1 T C 8: 104,523,637 D208G probably benign Het
Npepps A T 11: 97,218,548 V734E probably damaging Het
Ogdh A G 11: 6,349,390 N752S probably damaging Het
Olfr1094 A G 2: 86,829,654 I301V possibly damaging Het
Olfr266 T C 3: 106,822,187 D124G probably damaging Het
Olfr401 A T 11: 74,121,721 Q144L possibly damaging Het
Olfr906 T C 9: 38,488,377 M116T probably benign Het
Otof C A 5: 30,414,544 G171V probably damaging Het
Phtf2 A T 5: 20,801,941 V208D probably damaging Het
Pkn1 T A 8: 83,683,591 T340S probably damaging Het
Plcd4 C T 1: 74,563,594 L668F possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prss50 A T 9: 110,861,299 D170V probably damaging Het
Ptprg T C 14: 12,237,118 V604A probably damaging Het
Rab33b T C 3: 51,493,405 V100A probably damaging Het
Rbm26 T A 14: 105,131,535 D736V probably damaging Het
Rela C A 19: 5,646,964 P400T probably benign Het
Rpusd4 T C 9: 35,268,038 L50P probably damaging Het
Scn10a A C 9: 119,627,115 Y1214D probably damaging Het
Sema3c A G 5: 17,672,432 E179G probably damaging Het
Skint5 T A 4: 113,517,133 D1253V unknown Het
Sp4 G T 12: 118,238,178 P771H probably damaging Het
Sphkap T A 1: 83,278,378 Y263F probably damaging Het
Ssbp1 G A 6: 40,476,753 V78I probably benign Het
St3gal6 A G 16: 58,486,406 I87T probably benign Het
Tango6 T A 8: 106,818,497 D997E probably benign Het
Tpr C T 1: 150,445,888 P2265S possibly damaging Het
Ttc7b A T 12: 100,325,677 F212Y probably damaging Het
Ubc A G 5: 125,388,260 M1T probably null Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Yes1 T C 5: 32,651,686 I132T possibly damaging Het
Ythdc2 A G 18: 44,860,377 T830A probably benign Het
Zbtb41 T A 1: 139,430,306 F451I possibly damaging Het
Zfp995 C T 17: 21,880,512 C247Y probably benign Het
Other mutations in Nelfe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Nelfe APN 17 34853616 missense possibly damaging 0.81
IGL02227:Nelfe APN 17 34854354 missense probably benign 0.09
FR4342:Nelfe UTSW 17 34854089 unclassified probably benign
FR4548:Nelfe UTSW 17 34854070 unclassified probably benign
R0007:Nelfe UTSW 17 34853986 unclassified probably benign
R0563:Nelfe UTSW 17 34854239 missense possibly damaging 0.55
R2213:Nelfe UTSW 17 34853883 missense probably benign 0.03
R3802:Nelfe UTSW 17 34853901 missense possibly damaging 0.93
R5892:Nelfe UTSW 17 34854669 unclassified probably benign
R6625:Nelfe UTSW 17 34854358 missense probably benign 0.44
R6977:Nelfe UTSW 17 34854712 missense probably damaging 1.00
R7106:Nelfe UTSW 17 34852419 splice site probably null
R7205:Nelfe UTSW 17 34850936 synonymous probably null
RF055:Nelfe UTSW 17 34854062 unclassified probably benign
RF056:Nelfe UTSW 17 34854071 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CACTGTATGTGTATGGAGAGGAC -3'
(R):5'- CAGAGGACGGGCATTACATG -3'

Sequencing Primer
(F):5'- CTGTATGTGTATGGAGAGGACATGAC -3'
(R):5'- CATTACATGGAGCCAGGTGC -3'
Posted On2018-04-02