Incidental Mutation 'R6321:Chrnd'
ID 510325
Institutional Source Beutler Lab
Gene Symbol Chrnd
Ensembl Gene ENSMUSG00000026251
Gene Name cholinergic receptor, nicotinic, delta polypeptide
Synonyms Acrd, Achr-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock # R6321 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 87190607-87200070 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 87192229 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 90 (R90C)
Ref Sequence ENSEMBL: ENSMUSP00000072983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044533] [ENSMUST00000073252] [ENSMUST00000186373]
AlphaFold P02716
Predicted Effect probably benign
Transcript: ENSMUST00000044533
SMART Domains Protein: ENSMUSP00000138773
Gene: ENSMUSG00000036480

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Tryp_SPc 58 103 1e-5 BLAST
Tryp_SPc 108 336 1.17e-84 SMART
Blast:Tryp_SPc 340 385 4e-9 BLAST
low complexity region 386 407 N/A INTRINSIC
low complexity region 410 422 N/A INTRINSIC
Blast:Tryp_SPc 432 499 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000073252
AA Change: R90C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072983
Gene: ENSMUSG00000026251
AA Change: R90C

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:Neur_chan_LBD 28 249 4.4e-70 PFAM
Pfam:Neur_chan_memb 256 492 1.1e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186373
SMART Domains Protein: ENSMUSP00000139537
Gene: ENSMUSG00000026251

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 1 140 4.2e-40 PFAM
Pfam:Neur_chan_memb 147 383 6.6e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189970
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: This gene encodes the delta subunit of the muscle-derived nicotinic acetylcholine receptor, a pentameric neurotransmitter receptor and member of the ligand-gated ion channel superfamily. The delta subunit together with the alpha subunit forms the ligand-binding site. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,257,006 probably null Het
Actbl2 G T 13: 111,255,381 M83I probably damaging Het
Adgra2 T A 8: 27,114,162 M460K probably benign Het
Aldh16a1 G A 7: 45,149,765 A31V probably damaging Het
Ank2 T C 3: 126,946,938 probably benign Het
Arrdc4 C A 7: 68,749,045 D8Y probably benign Het
Auts2 A G 5: 131,466,115 Y110H probably damaging Het
Blnk A T 19: 40,934,459 Y405N probably damaging Het
Capsl T C 15: 9,461,769 F84L probably damaging Het
Cenpl T C 1: 161,074,895 S46P probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cyfip2 A T 11: 46,291,520 M37K probably benign Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Dnah5 T G 15: 28,372,411 V2936G probably damaging Het
Dock9 A G 14: 121,546,021 M2055T probably damaging Het
Epb41l2 A T 10: 25,468,128 R274S probably damaging Het
Erich3 A T 3: 154,727,502 H371L probably damaging Het
Evi5l C A 8: 4,203,080 P454T probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Golgb1 T A 16: 36,918,197 C2299* probably null Het
Heca G C 10: 17,915,243 probably null Het
Hecw1 C T 13: 14,522,829 A9T probably benign Het
Hs3st6 T A 17: 24,758,568 W341R probably damaging Het
Kidins220 C T 12: 25,057,534 S1571L probably benign Het
Klk9 A G 7: 43,794,308 E82G probably damaging Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Mecom A G 3: 29,980,592 Y502H probably damaging Het
Mfsd2a A G 4: 122,949,372 V372A probably benign Het
Mrgprd A G 7: 145,322,142 D250G probably benign Het
Muc2 A G 7: 141,700,828 D191G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr1312 A G 2: 112,042,768 V88A probably benign Het
Olfr692 A G 7: 105,368,902 Y192C probably damaging Het
Pnpla6 T C 8: 3,544,015 V1342A probably benign Het
Ppp1r9a A G 6: 5,115,151 E789G probably damaging Het
Prkdc A G 16: 15,714,919 T1471A probably benign Het
Scarb1 T A 5: 125,304,331 S50C probably damaging Het
Slc4a8 C T 15: 100,789,164 T283M probably damaging Het
Smc2 C A 4: 52,462,814 D601E probably benign Het
Snx6 C A 12: 54,752,013 V221F probably damaging Het
Spag17 A C 3: 100,088,427 K1794T probably benign Het
Tpo A G 12: 30,103,108 W416R probably damaging Het
Ttc13 C A 8: 124,683,191 K427N probably damaging Het
Upf3a A T 8: 13,787,466 N137I possibly damaging Het
Ush2a C T 1: 188,849,046 Q3708* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp451 A G 1: 33,813,735 F33L probably damaging Het
Zfp454 A G 11: 50,873,049 F408L probably damaging Het
Zfp639 T C 3: 32,517,088 Y40H probably damaging Het
Other mutations in Chrnd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Chrnd APN 1 87192927 nonsense probably null
IGL00754:Chrnd APN 1 87195784 missense probably benign 0.00
IGL00765:Chrnd APN 1 87195709 missense probably damaging 1.00
IGL01666:Chrnd APN 1 87198736 missense possibly damaging 0.55
IGL03179:Chrnd APN 1 87195780 missense probably damaging 1.00
R0071:Chrnd UTSW 1 87192837 splice site probably benign
R0071:Chrnd UTSW 1 87192837 splice site probably benign
R0531:Chrnd UTSW 1 87194819 missense probably damaging 1.00
R1164:Chrnd UTSW 1 87192545 missense probably benign
R1386:Chrnd UTSW 1 87192590 missense probably damaging 0.97
R1768:Chrnd UTSW 1 87194928 missense probably benign
R1780:Chrnd UTSW 1 87192548 missense possibly damaging 0.52
R2336:Chrnd UTSW 1 87194893 missense probably damaging 1.00
R4093:Chrnd UTSW 1 87191007 nonsense probably null
R4424:Chrnd UTSW 1 87195790 missense probably benign 0.38
R4467:Chrnd UTSW 1 87197377 missense probably damaging 0.99
R4828:Chrnd UTSW 1 87191571 splice site probably benign
R5701:Chrnd UTSW 1 87197658 missense possibly damaging 0.77
R5895:Chrnd UTSW 1 87195667 splice site probably null
R6159:Chrnd UTSW 1 87191090 missense probably benign
R6927:Chrnd UTSW 1 87198712 missense probably damaging 1.00
R7189:Chrnd UTSW 1 87191058 missense probably damaging 1.00
R7242:Chrnd UTSW 1 87197479 missense probably damaging 0.99
R7420:Chrnd UTSW 1 87194821 missense possibly damaging 0.89
R7996:Chrnd UTSW 1 87191106 missense probably damaging 1.00
R8501:Chrnd UTSW 1 87192616 missense probably damaging 1.00
R8944:Chrnd UTSW 1 87192275 missense probably damaging 1.00
R8963:Chrnd UTSW 1 87194881 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATAGAAACAAGCCAGTCTGG -3'
(R):5'- AATCACTGTGTGTCCTGGCTG -3'

Sequencing Primer
(F):5'- CGTGGAAATTGTGCCCCTTAG -3'
(R):5'- TGGCTGGCCAGGAACCG -3'
Posted On 2018-04-02