Incidental Mutation 'R6321:Zfp639'
ID510330
Institutional Source Beutler Lab
Gene Symbol Zfp639
Ensembl Gene ENSMUSG00000027667
Gene Namezinc finger protein 639
Synonyms6230400O18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R6321 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location32510259-32520833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32517088 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 40 (Y40H)
Ref Sequence ENSEMBL: ENSMUSP00000142244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029203] [ENSMUST00000191783] [ENSMUST00000192985] [ENSMUST00000193119] [ENSMUST00000193287]
Predicted Effect probably damaging
Transcript: ENSMUST00000029203
AA Change: Y40H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029203
Gene: ENSMUSG00000027667
AA Change: Y40H

DomainStartEndE-ValueType
ZnF_C2H2 204 227 2.49e-1 SMART
ZnF_C2H2 233 255 8.09e-1 SMART
ZnF_C2H2 260 283 1.16e-1 SMART
ZnF_C2H2 289 311 2.14e0 SMART
ZnF_C2H2 317 340 3.47e0 SMART
ZnF_C2H2 374 397 3.29e-1 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 454 2.86e-1 SMART
ZnF_C2H2 460 482 1.67e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191783
AA Change: Y40H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141446
Gene: ENSMUSG00000027667
AA Change: Y40H

DomainStartEndE-ValueType
ZnF_C2H2 204 227 2.49e-1 SMART
ZnF_C2H2 233 255 8.09e-1 SMART
ZnF_C2H2 260 283 1.16e-1 SMART
ZnF_C2H2 289 311 2.14e0 SMART
ZnF_C2H2 317 340 3.47e0 SMART
ZnF_C2H2 374 397 3.29e-1 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 454 2.86e-1 SMART
ZnF_C2H2 460 482 1.67e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192741
Predicted Effect probably benign
Transcript: ENSMUST00000192985
Predicted Effect probably damaging
Transcript: ENSMUST00000193119
AA Change: Y40H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000193287
AA Change: Y40H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141341
Gene: ENSMUSG00000027667
AA Change: Y40H

DomainStartEndE-ValueType
ZnF_C2H2 204 227 2.49e-1 SMART
ZnF_C2H2 233 255 8.09e-1 SMART
ZnF_C2H2 260 283 1.16e-1 SMART
ZnF_C2H2 289 311 2.14e0 SMART
ZnF_C2H2 317 340 3.47e0 SMART
ZnF_C2H2 374 397 3.29e-1 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 454 2.86e-1 SMART
ZnF_C2H2 460 482 1.67e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193290
Predicted Effect unknown
Transcript: ENSMUST00000193789
AA Change: Y3H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194821
Meta Mutation Damage Score 0.3569 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel-like zinc finger family of proteins. Amplification and overexpression of this gene have been observed in esophageal squamous cell carcinoma. The encoded protein has been shown to bind DNA in a sequence-specific manner and may regulate HIV-1 gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,257,006 probably null Het
Actbl2 G T 13: 111,255,381 M83I probably damaging Het
Adgra2 T A 8: 27,114,162 M460K probably benign Het
Aldh16a1 G A 7: 45,149,765 A31V probably damaging Het
Ank2 T C 3: 126,946,938 probably benign Het
Arrdc4 C A 7: 68,749,045 D8Y probably benign Het
Auts2 A G 5: 131,466,115 Y110H probably damaging Het
Blnk A T 19: 40,934,459 Y405N probably damaging Het
Capsl T C 15: 9,461,769 F84L probably damaging Het
Cenpl T C 1: 161,074,895 S46P probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chrnd C T 1: 87,192,229 R90C probably damaging Het
Cyfip2 A T 11: 46,291,520 M37K probably benign Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Dnah5 T G 15: 28,372,411 V2936G probably damaging Het
Dock9 A G 14: 121,546,021 M2055T probably damaging Het
Epb41l2 A T 10: 25,468,128 R274S probably damaging Het
Erich3 A T 3: 154,727,502 H371L probably damaging Het
Evi5l C A 8: 4,203,080 P454T probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Golgb1 T A 16: 36,918,197 C2299* probably null Het
Heca G C 10: 17,915,243 probably null Het
Hecw1 C T 13: 14,522,829 A9T probably benign Het
Hs3st6 T A 17: 24,758,568 W341R probably damaging Het
Kidins220 C T 12: 25,057,534 S1571L probably benign Het
Klk9 A G 7: 43,794,308 E82G probably damaging Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Mecom A G 3: 29,980,592 Y502H probably damaging Het
Mfsd2a A G 4: 122,949,372 V372A probably benign Het
Mrgprd A G 7: 145,322,142 D250G probably benign Het
Muc2 A G 7: 141,700,828 D191G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr1312 A G 2: 112,042,768 V88A probably benign Het
Olfr692 A G 7: 105,368,902 Y192C probably damaging Het
Pnpla6 T C 8: 3,544,015 V1342A probably benign Het
Ppp1r9a A G 6: 5,115,151 E789G probably damaging Het
Prkdc A G 16: 15,714,919 T1471A probably benign Het
Scarb1 T A 5: 125,304,331 S50C probably damaging Het
Slc4a8 C T 15: 100,789,164 T283M probably damaging Het
Smc2 C A 4: 52,462,814 D601E probably benign Het
Snx6 C A 12: 54,752,013 V221F probably damaging Het
Spag17 A C 3: 100,088,427 K1794T probably benign Het
Tpo A G 12: 30,103,108 W416R probably damaging Het
Ttc13 C A 8: 124,683,191 K427N probably damaging Het
Upf3a A T 8: 13,787,466 N137I possibly damaging Het
Ush2a C T 1: 188,849,046 Q3708* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp451 A G 1: 33,813,735 F33L probably damaging Het
Zfp454 A G 11: 50,873,049 F408L probably damaging Het
Other mutations in Zfp639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Zfp639 APN 3 32519753 intron probably null
IGL00571:Zfp639 APN 3 32519919 missense probably damaging 0.99
IGL00579:Zfp639 APN 3 32520477 missense probably damaging 0.98
IGL01952:Zfp639 APN 3 32515347 missense probably damaging 1.00
PIT4514001:Zfp639 UTSW 3 32520260 missense possibly damaging 0.46
R0412:Zfp639 UTSW 3 32517110 missense possibly damaging 0.92
R1195:Zfp639 UTSW 3 32519196 missense possibly damaging 0.92
R1195:Zfp639 UTSW 3 32519196 missense possibly damaging 0.92
R1195:Zfp639 UTSW 3 32519196 missense possibly damaging 0.92
R2906:Zfp639 UTSW 3 32519751 missense probably damaging 0.99
R4660:Zfp639 UTSW 3 32520530 missense probably damaging 0.99
R5109:Zfp639 UTSW 3 32520436 utr 3 prime probably null
R6012:Zfp639 UTSW 3 32519122 missense probably damaging 1.00
R6449:Zfp639 UTSW 3 32519661 missense possibly damaging 0.92
R7020:Zfp639 UTSW 3 32520112 missense probably damaging 0.98
R8034:Zfp639 UTSW 3 32520066 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGGGTCCAATCTTTAACACTG -3'
(R):5'- ACCTTTTCGGATAGTTCCCAAG -3'

Sequencing Primer
(F):5'- CCAATCTTTAACACTGGGAGAAAAAG -3'
(R):5'- TCGGATAGTTCCCAAGAGAAAATAC -3'
Posted On2018-04-02