Incidental Mutation 'R6321:Chd1l'
ID510331
Institutional Source Beutler Lab
Gene Symbol Chd1l
Ensembl Gene ENSMUSG00000028089
Gene Namechromodomain helicase DNA binding protein 1-like
Synonyms4432404A22Rik, Snf2p
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock #R6321 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location97560742-97610203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 97587167 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 399 (A399V)
Ref Sequence ENSEMBL: ENSMUSP00000029730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029730]
Predicted Effect probably damaging
Transcript: ENSMUST00000029730
AA Change: A399V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029730
Gene: ENSMUSG00000028089
AA Change: A399V

DomainStartEndE-ValueType
DEXDc 36 224 1.83e-38 SMART
HELICc 371 453 7.45e-21 SMART
low complexity region 548 570 N/A INTRINSIC
coiled coil region 643 680 N/A INTRINSIC
low complexity region 692 709 N/A INTRINSIC
PDB:2FG1|A 718 878 6e-9 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197304
Meta Mutation Damage Score 0.3595 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase protein involved in DNA repair. The protein converts ATP to add poly(ADP-ribose) as it regulates chromatin relaxation following DNA damage. Overexpression of this gene has been linked to several types of cancers. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,257,006 probably null Het
Actbl2 G T 13: 111,255,381 M83I probably damaging Het
Adgra2 T A 8: 27,114,162 M460K probably benign Het
Aldh16a1 G A 7: 45,149,765 A31V probably damaging Het
Ank2 T C 3: 126,946,938 probably benign Het
Arrdc4 C A 7: 68,749,045 D8Y probably benign Het
Auts2 A G 5: 131,466,115 Y110H probably damaging Het
Blnk A T 19: 40,934,459 Y405N probably damaging Het
Capsl T C 15: 9,461,769 F84L probably damaging Het
Cenpl T C 1: 161,074,895 S46P probably benign Het
Chrnd C T 1: 87,192,229 R90C probably damaging Het
Cyfip2 A T 11: 46,291,520 M37K probably benign Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Dnah5 T G 15: 28,372,411 V2936G probably damaging Het
Dock9 A G 14: 121,546,021 M2055T probably damaging Het
Epb41l2 A T 10: 25,468,128 R274S probably damaging Het
Erich3 A T 3: 154,727,502 H371L probably damaging Het
Evi5l C A 8: 4,203,080 P454T probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Golgb1 T A 16: 36,918,197 C2299* probably null Het
Heca G C 10: 17,915,243 probably null Het
Hecw1 C T 13: 14,522,829 A9T probably benign Het
Hs3st6 T A 17: 24,758,568 W341R probably damaging Het
Kidins220 C T 12: 25,057,534 S1571L probably benign Het
Klk9 A G 7: 43,794,308 E82G probably damaging Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Mecom A G 3: 29,980,592 Y502H probably damaging Het
Mfsd2a A G 4: 122,949,372 V372A probably benign Het
Mrgprd A G 7: 145,322,142 D250G probably benign Het
Muc2 A G 7: 141,700,828 D191G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr1312 A G 2: 112,042,768 V88A probably benign Het
Olfr692 A G 7: 105,368,902 Y192C probably damaging Het
Pnpla6 T C 8: 3,544,015 V1342A probably benign Het
Ppp1r9a A G 6: 5,115,151 E789G probably damaging Het
Prkdc A G 16: 15,714,919 T1471A probably benign Het
Scarb1 T A 5: 125,304,331 S50C probably damaging Het
Slc4a8 C T 15: 100,789,164 T283M probably damaging Het
Smc2 C A 4: 52,462,814 D601E probably benign Het
Snx6 C A 12: 54,752,013 V221F probably damaging Het
Spag17 A C 3: 100,088,427 K1794T probably benign Het
Tpo A G 12: 30,103,108 W416R probably damaging Het
Ttc13 C A 8: 124,683,191 K427N probably damaging Het
Upf3a A T 8: 13,787,466 N137I possibly damaging Het
Ush2a C T 1: 188,849,046 Q3708* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp451 A G 1: 33,813,735 F33L probably damaging Het
Zfp454 A G 11: 50,873,049 F408L probably damaging Het
Zfp639 T C 3: 32,517,088 Y40H probably damaging Het
Other mutations in Chd1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Chd1l APN 3 97590605 missense probably damaging 1.00
IGL01349:Chd1l APN 3 97591234 missense probably benign 0.07
IGL02115:Chd1l APN 3 97589904 critical splice donor site probably null
IGL02418:Chd1l APN 3 97581099 missense probably benign 0.39
IGL02717:Chd1l APN 3 97583907 missense probably damaging 1.00
IGL03091:Chd1l APN 3 97563547 missense probably damaging 1.00
IGL03048:Chd1l UTSW 3 97597763 missense probably benign 0.01
R0125:Chd1l UTSW 3 97587149 missense probably benign 0.00
R0702:Chd1l UTSW 3 97566794 missense probably benign 0.05
R1226:Chd1l UTSW 3 97562625 nonsense probably null
R1237:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1238:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1239:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1301:Chd1l UTSW 3 97603648 splice site probably benign
R1366:Chd1l UTSW 3 97581149 missense probably damaging 0.99
R1444:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1445:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1500:Chd1l UTSW 3 97582805 missense probably benign 0.01
R1619:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1640:Chd1l UTSW 3 97580991 missense probably benign 0.00
R1762:Chd1l UTSW 3 97588299 missense probably damaging 1.00
R2291:Chd1l UTSW 3 97591283 missense probably damaging 1.00
R2444:Chd1l UTSW 3 97590566 missense probably damaging 1.00
R4008:Chd1l UTSW 3 97570402 missense probably benign 0.01
R4011:Chd1l UTSW 3 97570402 missense probably benign 0.01
R4106:Chd1l UTSW 3 97597703 missense probably benign 0.09
R4857:Chd1l UTSW 3 97572659 missense probably benign 0.27
R5008:Chd1l UTSW 3 97583908 missense probably damaging 1.00
R5337:Chd1l UTSW 3 97562616 missense probably damaging 1.00
R5844:Chd1l UTSW 3 97572567 missense probably benign 0.04
R6283:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6298:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6309:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6311:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6327:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6364:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6366:Chd1l UTSW 3 97594160 missense probably benign 0.00
R6467:Chd1l UTSW 3 97563533 missense probably damaging 0.97
R6483:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6493:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6494:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6585:Chd1l UTSW 3 97597772 missense probably damaging 0.96
R6925:Chd1l UTSW 3 97582826 missense probably damaging 1.00
R7148:Chd1l UTSW 3 97591316 missense probably damaging 1.00
R7244:Chd1l UTSW 3 97597750 missense probably damaging 1.00
R8111:Chd1l UTSW 3 97587210 missense possibly damaging 0.95
R8346:Chd1l UTSW 3 97562643 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCAACGGCCTCAATTCTCTC -3'
(R):5'- TCCCTAAAGGTAGACTCCCC -3'

Sequencing Primer
(F):5'- CCTTTTTACCCCTTAGTAATGGC -3'
(R):5'- CCCTTGGGAATGATTAGAATTGG -3'
Posted On2018-04-02