Incidental Mutation 'R6321:Smc2'
ID510335
Institutional Source Beutler Lab
Gene Symbol Smc2
Ensembl Gene ENSMUSG00000028312
Gene Namestructural maintenance of chromosomes 2
SynonymsCAP-E, Fin16, 5730502P04Rik, Smc2l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R6321 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location52439243-52488260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 52462814 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 601 (D601E)
Ref Sequence ENSEMBL: ENSMUSP00000113940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102915] [ENSMUST00000117280] [ENSMUST00000142227]
Predicted Effect probably benign
Transcript: ENSMUST00000102915
AA Change: D601E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099979
Gene: ENSMUSG00000028312
AA Change: D601E

DomainStartEndE-ValueType
internal_repeat_1 146 174 2.4e-6 PROSPERO
low complexity region 183 207 N/A INTRINSIC
coiled coil region 238 355 N/A INTRINSIC
coiled coil region 400 503 N/A INTRINSIC
SMC_hinge 520 640 3.8e-34 SMART
coiled coil region 676 880 N/A INTRINSIC
coiled coil region 984 1031 N/A INTRINSIC
PDB:4I99|B 1034 1186 3e-15 PDB
SCOP:d1e69a_ 1066 1144 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117280
AA Change: D601E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113940
Gene: ENSMUSG00000028312
AA Change: D601E

DomainStartEndE-ValueType
Pfam:AAA_21 27 131 3.8e-6 PFAM
internal_repeat_1 146 174 2.4e-6 PROSPERO
low complexity region 183 207 N/A INTRINSIC
coiled coil region 238 355 N/A INTRINSIC
coiled coil region 400 503 N/A INTRINSIC
SMC_hinge 520 640 3.8e-34 SMART
coiled coil region 676 880 N/A INTRINSIC
coiled coil region 984 1031 N/A INTRINSIC
PDB:4I99|B 1034 1186 3e-15 PDB
SCOP:d1e69a_ 1066 1144 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142227
SMART Domains Protein: ENSMUSP00000114228
Gene: ENSMUSG00000028312

DomainStartEndE-ValueType
Pfam:SMC_N 2 351 2.3e-36 PFAM
Pfam:AAA_21 27 131 1.7e-8 PFAM
coiled coil region 400 471 N/A INTRINSIC
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: The protein encoded by this gene is a component of both condensin I and condensin II complexes, and forms a heterodimer with structural maintenance of chromosome 4 (Smc4). This heterodimer is the catalytic subunit for both condensin complexes, and is involved in several processes, including chromosome condensation during mitosis and meiosis, cohesin removal during mitosis and meiosis, and single-strand break (SSB) repair. Reduced expression of this gene results in chromosome segregation defects during mitosis and meiosis, with a more severe defect observed in embryonic stem cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice die embryonically. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,257,006 probably null Het
Actbl2 G T 13: 111,255,381 M83I probably damaging Het
Adgra2 T A 8: 27,114,162 M460K probably benign Het
Aldh16a1 G A 7: 45,149,765 A31V probably damaging Het
Ank2 T C 3: 126,946,938 probably benign Het
Arrdc4 C A 7: 68,749,045 D8Y probably benign Het
Auts2 A G 5: 131,466,115 Y110H probably damaging Het
Blnk A T 19: 40,934,459 Y405N probably damaging Het
Capsl T C 15: 9,461,769 F84L probably damaging Het
Cenpl T C 1: 161,074,895 S46P probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chrnd C T 1: 87,192,229 R90C probably damaging Het
Cyfip2 A T 11: 46,291,520 M37K probably benign Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Dnah5 T G 15: 28,372,411 V2936G probably damaging Het
Dock9 A G 14: 121,546,021 M2055T probably damaging Het
Epb41l2 A T 10: 25,468,128 R274S probably damaging Het
Erich3 A T 3: 154,727,502 H371L probably damaging Het
Evi5l C A 8: 4,203,080 P454T probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Golgb1 T A 16: 36,918,197 C2299* probably null Het
Heca G C 10: 17,915,243 probably null Het
Hecw1 C T 13: 14,522,829 A9T probably benign Het
Hs3st6 T A 17: 24,758,568 W341R probably damaging Het
Kidins220 C T 12: 25,057,534 S1571L probably benign Het
Klk9 A G 7: 43,794,308 E82G probably damaging Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Mecom A G 3: 29,980,592 Y502H probably damaging Het
Mfsd2a A G 4: 122,949,372 V372A probably benign Het
Mrgprd A G 7: 145,322,142 D250G probably benign Het
Muc2 A G 7: 141,700,828 D191G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr1312 A G 2: 112,042,768 V88A probably benign Het
Olfr692 A G 7: 105,368,902 Y192C probably damaging Het
Pnpla6 T C 8: 3,544,015 V1342A probably benign Het
Ppp1r9a A G 6: 5,115,151 E789G probably damaging Het
Prkdc A G 16: 15,714,919 T1471A probably benign Het
Scarb1 T A 5: 125,304,331 S50C probably damaging Het
Slc4a8 C T 15: 100,789,164 T283M probably damaging Het
Snx6 C A 12: 54,752,013 V221F probably damaging Het
Spag17 A C 3: 100,088,427 K1794T probably benign Het
Tpo A G 12: 30,103,108 W416R probably damaging Het
Ttc13 C A 8: 124,683,191 K427N probably damaging Het
Upf3a A T 8: 13,787,466 N137I possibly damaging Het
Ush2a C T 1: 188,849,046 Q3708* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp451 A G 1: 33,813,735 F33L probably damaging Het
Zfp454 A G 11: 50,873,049 F408L probably damaging Het
Zfp639 T C 3: 32,517,088 Y40H probably damaging Het
Other mutations in Smc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Smc2 APN 4 52450842 missense probably damaging 1.00
IGL02045:Smc2 APN 4 52462914 missense probably benign 0.01
IGL03013:Smc2 APN 4 52442280 missense probably damaging 1.00
IGL03031:Smc2 APN 4 52449638 missense probably benign 0.35
IGL03246:Smc2 APN 4 52440301 nonsense probably null
Janitor UTSW 4 52478448 missense probably damaging 1.00
R0539:Smc2 UTSW 4 52458558 missense probably benign 0.01
R0782:Smc2 UTSW 4 52469799 missense probably benign 0.30
R1908:Smc2 UTSW 4 52450863 missense probably damaging 0.97
R2054:Smc2 UTSW 4 52462948 missense probably benign 0.00
R2109:Smc2 UTSW 4 52474987 missense probably benign 0.00
R2318:Smc2 UTSW 4 52446030 missense probably damaging 1.00
R2352:Smc2 UTSW 4 52460266 missense probably benign
R3418:Smc2 UTSW 4 52476850 splice site probably benign
R4003:Smc2 UTSW 4 52462897 missense probably damaging 1.00
R4133:Smc2 UTSW 4 52450947 missense probably damaging 0.99
R4299:Smc2 UTSW 4 52440238 utr 5 prime probably benign
R4547:Smc2 UTSW 4 52467866 missense probably benign 0.09
R4787:Smc2 UTSW 4 52462927 missense probably damaging 0.98
R4816:Smc2 UTSW 4 52451231 missense probably benign 0.00
R4829:Smc2 UTSW 4 52449612 missense probably damaging 0.98
R4861:Smc2 UTSW 4 52461090 missense probably benign 0.14
R4861:Smc2 UTSW 4 52461090 missense probably benign 0.14
R4951:Smc2 UTSW 4 52462926 missense possibly damaging 0.95
R4963:Smc2 UTSW 4 52450826 missense probably damaging 1.00
R4996:Smc2 UTSW 4 52461042 splice site probably null
R5028:Smc2 UTSW 4 52458447 missense probably damaging 0.96
R5103:Smc2 UTSW 4 52459033 missense probably damaging 1.00
R5159:Smc2 UTSW 4 52460181 missense possibly damaging 0.65
R5387:Smc2 UTSW 4 52475096 missense probably benign 0.16
R5697:Smc2 UTSW 4 52459045 missense probably benign 0.01
R6006:Smc2 UTSW 4 52459024 missense probably benign
R6246:Smc2 UTSW 4 52460289 missense probably damaging 1.00
R6590:Smc2 UTSW 4 52449375 missense probably benign 0.01
R6658:Smc2 UTSW 4 52451322 missense probably benign 0.21
R6690:Smc2 UTSW 4 52449375 missense probably benign 0.01
R7422:Smc2 UTSW 4 52440301 missense probably benign 0.02
R7486:Smc2 UTSW 4 52462861 missense possibly damaging 0.54
R7487:Smc2 UTSW 4 52478448 missense probably damaging 1.00
R7532:Smc2 UTSW 4 52451013 missense probably damaging 1.00
R7556:Smc2 UTSW 4 52457379 missense probably benign 0.03
R7912:Smc2 UTSW 4 52450854 missense probably benign 0.00
R7953:Smc2 UTSW 4 52470911 critical splice donor site probably null
R7979:Smc2 UTSW 4 52450857 missense probably damaging 1.00
R8343:Smc2 UTSW 4 52450965 missense probably benign
R8344:Smc2 UTSW 4 52449376 missense probably benign 0.01
RF006:Smc2 UTSW 4 52442276 missense probably benign 0.03
X0065:Smc2 UTSW 4 52440370 missense probably damaging 1.00
Z1176:Smc2 UTSW 4 52481682 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGAACTTGGTATCGGCTTC -3'
(R):5'- TCCACTCAATGTTCCATGAGG -3'

Sequencing Primer
(F):5'- CTGTGGACCAGAATAGTCTTGAACTC -3'
(R):5'- GTTCCATGAGGATCAAATACATCAC -3'
Posted On2018-04-02