Mutagenetix > Incidental Mutations

Incidental Mutation 'R6321:Smc2'

510335

Institutional Source

Beutler Lab

Gene Symbol

Smc2

Ensembl Gene

ENSMUSG00000028312

Gene Name

structural maintenance of chromosomes 2

Synonyms

CAP-E, Fin16, 5730502P04Rik, Smc2l1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R6321 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

52439243-52488260 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 52462814 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 601 (D601E)

Ref Sequence

ENSEMBL: ENSMUSP00000113940 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102915] [ENSMUST00000117280] [ENSMUST00000142227]

Predicted Effect

probably benign
Transcript: ENSMUST00000102915
AA Change: D601E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000099979
Gene: ENSMUSG00000028312
AA Change: D601E

Domain	Start	End	E-Value	Type
internal_repeat_1	146	174	2.4e-6	PROSPERO
low complexity region	183	207	N/A	INTRINSIC
coiled coil region	238	355	N/A	INTRINSIC
coiled coil region	400	503	N/A	INTRINSIC
SMC_hinge	520	640	3.8e-34	SMART
coiled coil region	676	880	N/A	INTRINSIC
coiled coil region	984	1031	N/A	INTRINSIC
PDB:4I99\|B	1034	1186	3e-15	PDB
SCOP:d1e69a_	1066	1144	2e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117280
AA Change: D601E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000113940
Gene: ENSMUSG00000028312
AA Change: D601E

Domain	Start	End	E-Value	Type
Pfam:AAA_21	27	131	3.8e-6	PFAM
internal_repeat_1	146	174	2.4e-6	PROSPERO
low complexity region	183	207	N/A	INTRINSIC
coiled coil region	238	355	N/A	INTRINSIC
coiled coil region	400	503	N/A	INTRINSIC
SMC_hinge	520	640	3.8e-34	SMART
coiled coil region	676	880	N/A	INTRINSIC
coiled coil region	984	1031	N/A	INTRINSIC
PDB:4I99\|B	1034	1186	3e-15	PDB
SCOP:d1e69a_	1066	1144	2e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142227

SMART Domains

Protein: ENSMUSP00000114228
Gene: ENSMUSG00000028312

Domain	Start	End	E-Value	Type
Pfam:SMC_N	2	351	2.3e-36	PFAM
Pfam:AAA_21	27	131	1.7e-8	PFAM
coiled coil region	400	471	N/A	INTRINSIC

Meta Mutation Damage Score

0.0664

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a component of both condensin I and condensin II complexes, and forms a heterodimer with structural maintenance of chromosome 4 (Smc4). This heterodimer is the catalytic subunit for both condensin complexes, and is involved in several processes, including chromosome condensation during mitosis and meiosis, cohesin removal during mitosis and meiosis, and single-strand break (SSB) repair. Reduced expression of this gene results in chromosome segregation defects during mitosis and meiosis, with a more severe defect observed in embryonic stem cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice die embryonically. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	T	C	7: 131,257,006		probably null	Het
Actbl2	G	T	13: 111,255,381	M83I	probably damaging	Het
Adgra2	T	A	8: 27,114,162	M460K	probably benign	Het
Aldh16a1	G	A	7: 45,149,765	A31V	probably damaging	Het
Ank2	T	C	3: 126,946,938		probably benign	Het
Arrdc4	C	A	7: 68,749,045	D8Y	probably benign	Het
Auts2	A	G	5: 131,466,115	Y110H	probably damaging	Het
Blnk	A	T	19: 40,934,459	Y405N	probably damaging	Het
Capsl	T	C	15: 9,461,769	F84L	probably damaging	Het
Cenpl	T	C	1: 161,074,895	S46P	probably benign	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Chrnd	C	T	1: 87,192,229	R90C	probably damaging	Het
Cyfip2	A	T	11: 46,291,520	M37K	probably benign	Het
Dnah11	T	C	12: 118,142,292	E625G	possibly damaging	Het
Dnah5	T	G	15: 28,372,411	V2936G	probably damaging	Het
Dock9	A	G	14: 121,546,021	M2055T	probably damaging	Het
Epb41l2	A	T	10: 25,468,128	R274S	probably damaging	Het
Erich3	A	T	3: 154,727,502	H371L	probably damaging	Het
Evi5l	C	A	8: 4,203,080	P454T	probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Golgb1	T	A	16: 36,918,197	C2299*	probably null	Het
Heca	G	C	10: 17,915,243		probably null	Het
Hecw1	C	T	13: 14,522,829	A9T	probably benign	Het
Hs3st6	T	A	17: 24,758,568	W341R	probably damaging	Het
Kidins220	C	T	12: 25,057,534	S1571L	probably benign	Het
Klk9	A	G	7: 43,794,308	E82G	probably damaging	Het
Ltbp3	C	A	19: 5,745,657	H180Q	probably benign	Het
Mecom	A	G	3: 29,980,592	Y502H	probably damaging	Het
Mfsd2a	A	G	4: 122,949,372	V372A	probably benign	Het
Mrgprd	A	G	7: 145,322,142	D250G	probably benign	Het
Muc2	A	G	7: 141,700,828	D191G	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naip6	C	A	13: 100,300,401	S538I	probably benign	Het
Olfr1312	A	G	2: 112,042,768	V88A	probably benign	Het
Olfr692	A	G	7: 105,368,902	Y192C	probably damaging	Het
Pnpla6	T	C	8: 3,544,015	V1342A	probably benign	Het
Ppp1r9a	A	G	6: 5,115,151	E789G	probably damaging	Het
Prkdc	A	G	16: 15,714,919	T1471A	probably benign	Het
Scarb1	T	A	5: 125,304,331	S50C	probably damaging	Het
Slc4a8	C	T	15: 100,789,164	T283M	probably damaging	Het
Snx6	C	A	12: 54,752,013	V221F	probably damaging	Het
Spag17	A	C	3: 100,088,427	K1794T	probably benign	Het
Tpo	A	G	12: 30,103,108	W416R	probably damaging	Het
Ttc13	C	A	8: 124,683,191	K427N	probably damaging	Het
Upf3a	A	T	8: 13,787,466	N137I	possibly damaging	Het
Ush2a	C	T	1: 188,849,046	Q3708*	probably null	Het
Zbtb17	G	A	4: 141,463,383	G171S	probably benign	Het
Zfp451	A	G	1: 33,813,735	F33L	probably damaging	Het
Zfp454	A	G	11: 50,873,049	F408L	probably damaging	Het
Zfp639	T	C	3: 32,517,088	Y40H	probably damaging	Het

Other mutations in Smc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01322:Smc2	APN	4	52450842	missense	probably damaging	1.00
IGL02045:Smc2	APN	4	52462914	missense	probably benign	0.01
IGL03013:Smc2	APN	4	52442280	missense	probably damaging	1.00
IGL03031:Smc2	APN	4	52449638	missense	probably benign	0.35
IGL03246:Smc2	APN	4	52440301	nonsense	probably null
Janitor	UTSW	4	52478448	missense	probably damaging	1.00
R0539:Smc2	UTSW	4	52458558	missense	probably benign	0.01
R0782:Smc2	UTSW	4	52469799	missense	probably benign	0.30
R1908:Smc2	UTSW	4	52450863	missense	probably damaging	0.97
R2054:Smc2	UTSW	4	52462948	missense	probably benign	0.00
R2109:Smc2	UTSW	4	52474987	missense	probably benign	0.00
R2318:Smc2	UTSW	4	52446030	missense	probably damaging	1.00
R2352:Smc2	UTSW	4	52460266	missense	probably benign
R3418:Smc2	UTSW	4	52476850	splice site	probably benign
R4003:Smc2	UTSW	4	52462897	missense	probably damaging	1.00
R4133:Smc2	UTSW	4	52450947	missense	probably damaging	0.99
R4299:Smc2	UTSW	4	52440238	utr 5 prime	probably benign
R4547:Smc2	UTSW	4	52467866	missense	probably benign	0.09
R4787:Smc2	UTSW	4	52462927	missense	probably damaging	0.98
R4816:Smc2	UTSW	4	52451231	missense	probably benign	0.00
R4829:Smc2	UTSW	4	52449612	missense	probably damaging	0.98
R4861:Smc2	UTSW	4	52461090	missense	probably benign	0.14
R4861:Smc2	UTSW	4	52461090	missense	probably benign	0.14
R4951:Smc2	UTSW	4	52462926	missense	possibly damaging	0.95
R4963:Smc2	UTSW	4	52450826	missense	probably damaging	1.00
R4996:Smc2	UTSW	4	52461042	splice site	probably null
R5028:Smc2	UTSW	4	52458447	missense	probably damaging	0.96
R5103:Smc2	UTSW	4	52459033	missense	probably damaging	1.00
R5159:Smc2	UTSW	4	52460181	missense	possibly damaging	0.65
R5387:Smc2	UTSW	4	52475096	missense	probably benign	0.16
R5697:Smc2	UTSW	4	52459045	missense	probably benign	0.01
R6006:Smc2	UTSW	4	52459024	missense	probably benign
R6246:Smc2	UTSW	4	52460289	missense	probably damaging	1.00
R6590:Smc2	UTSW	4	52449375	missense	probably benign	0.01
R6658:Smc2	UTSW	4	52451322	missense	probably benign	0.21
R6690:Smc2	UTSW	4	52449375	missense	probably benign	0.01
R7422:Smc2	UTSW	4	52440301	missense	probably benign	0.02
R7486:Smc2	UTSW	4	52462861	missense	possibly damaging	0.54
R7487:Smc2	UTSW	4	52478448	missense	probably damaging	1.00
R7532:Smc2	UTSW	4	52451013	missense	probably damaging	1.00
R7556:Smc2	UTSW	4	52457379	missense	probably benign	0.03
R7912:Smc2	UTSW	4	52450854	missense	probably benign	0.00
R7953:Smc2	UTSW	4	52470911	critical splice donor site	probably null
R7979:Smc2	UTSW	4	52450857	missense	probably damaging	1.00
R8343:Smc2	UTSW	4	52450965	missense	probably benign
R8344:Smc2	UTSW	4	52449376	missense	probably benign	0.01
RF006:Smc2	UTSW	4	52442276	missense	probably benign	0.03
X0065:Smc2	UTSW	4	52440370	missense	probably damaging	1.00
Z1176:Smc2	UTSW	4	52481682	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCGAACTTGGTATCGGCTTC -3'
(R):5'- TCCACTCAATGTTCCATGAGG -3'

Sequencing Primer
(F):5'- CTGTGGACCAGAATAGTCTTGAACTC -3'
(R):5'- GTTCCATGAGGATCAAATACATCAC -3'

Posted On

2018-04-02