Incidental Mutation 'R6321:Mfsd2a'
ID 510336
Institutional Source Beutler Lab
Gene Symbol Mfsd2a
Ensembl Gene ENSMUSG00000028655
Gene Name major facilitator superfamily domain containing 2A
Synonyms 1700018O18Rik, Mfsd2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock # R6321 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 122946850-122961188 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 122949372 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 372 (V372A)
Ref Sequence ENSEMBL: ENSMUSP00000030408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030408]
AlphaFold Q9DA75
Predicted Effect probably benign
Transcript: ENSMUST00000030408
AA Change: V372A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000030408
Gene: ENSMUSG00000028655
AA Change: V372A

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 27 39 N/A INTRINSIC
Pfam:MFS_2 44 500 1.7e-96 PFAM
Pfam:MFS_1 57 450 9.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152308
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show partial postnatal lethality, reduced body weight, ataxia, and alterations in lipid metabolism and photoreceptor cell development. Homozygotes for a different null allele show a leaky blood-brain barrier and increased CNS-endothelial-cell vesicular transcytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,257,006 probably null Het
Actbl2 G T 13: 111,255,381 M83I probably damaging Het
Adgra2 T A 8: 27,114,162 M460K probably benign Het
Aldh16a1 G A 7: 45,149,765 A31V probably damaging Het
Ank2 T C 3: 126,946,938 probably benign Het
Arrdc4 C A 7: 68,749,045 D8Y probably benign Het
Auts2 A G 5: 131,466,115 Y110H probably damaging Het
Blnk A T 19: 40,934,459 Y405N probably damaging Het
Capsl T C 15: 9,461,769 F84L probably damaging Het
Cenpl T C 1: 161,074,895 S46P probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chrnd C T 1: 87,192,229 R90C probably damaging Het
Cyfip2 A T 11: 46,291,520 M37K probably benign Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Dnah5 T G 15: 28,372,411 V2936G probably damaging Het
Dock9 A G 14: 121,546,021 M2055T probably damaging Het
Epb41l2 A T 10: 25,468,128 R274S probably damaging Het
Erich3 A T 3: 154,727,502 H371L probably damaging Het
Evi5l C A 8: 4,203,080 P454T probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Golgb1 T A 16: 36,918,197 C2299* probably null Het
Heca G C 10: 17,915,243 probably null Het
Hecw1 C T 13: 14,522,829 A9T probably benign Het
Hs3st6 T A 17: 24,758,568 W341R probably damaging Het
Kidins220 C T 12: 25,057,534 S1571L probably benign Het
Klk9 A G 7: 43,794,308 E82G probably damaging Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Mecom A G 3: 29,980,592 Y502H probably damaging Het
Mrgprd A G 7: 145,322,142 D250G probably benign Het
Muc2 A G 7: 141,700,828 D191G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr1312 A G 2: 112,042,768 V88A probably benign Het
Olfr692 A G 7: 105,368,902 Y192C probably damaging Het
Pnpla6 T C 8: 3,544,015 V1342A probably benign Het
Ppp1r9a A G 6: 5,115,151 E789G probably damaging Het
Prkdc A G 16: 15,714,919 T1471A probably benign Het
Scarb1 T A 5: 125,304,331 S50C probably damaging Het
Slc4a8 C T 15: 100,789,164 T283M probably damaging Het
Smc2 C A 4: 52,462,814 D601E probably benign Het
Snx6 C A 12: 54,752,013 V221F probably damaging Het
Spag17 A C 3: 100,088,427 K1794T probably benign Het
Tpo A G 12: 30,103,108 W416R probably damaging Het
Ttc13 C A 8: 124,683,191 K427N probably damaging Het
Upf3a A T 8: 13,787,466 N137I possibly damaging Het
Ush2a C T 1: 188,849,046 Q3708* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp451 A G 1: 33,813,735 F33L probably damaging Het
Zfp454 A G 11: 50,873,049 F408L probably damaging Het
Zfp639 T C 3: 32,517,088 Y40H probably damaging Het
Other mutations in Mfsd2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Mfsd2a APN 4 122949307 missense probably benign 0.32
IGL02756:Mfsd2a APN 4 122948539 missense probably benign 0.30
azure UTSW 4 122952021 missense possibly damaging 0.66
R0355:Mfsd2a UTSW 4 122951839 missense possibly damaging 0.64
R0394:Mfsd2a UTSW 4 122950168 missense probably benign 0.26
R2002:Mfsd2a UTSW 4 122956816 missense probably damaging 1.00
R2516:Mfsd2a UTSW 4 122950487 missense probably damaging 1.00
R2943:Mfsd2a UTSW 4 122948589 missense possibly damaging 0.87
R3052:Mfsd2a UTSW 4 122951842 missense probably damaging 1.00
R4811:Mfsd2a UTSW 4 122959382 missense probably benign 0.28
R4977:Mfsd2a UTSW 4 122950509 missense probably benign
R5030:Mfsd2a UTSW 4 122950156 missense possibly damaging 0.90
R5231:Mfsd2a UTSW 4 122959301 missense possibly damaging 0.88
R5735:Mfsd2a UTSW 4 122949327 missense probably damaging 0.98
R6173:Mfsd2a UTSW 4 122951246 missense probably benign
R6433:Mfsd2a UTSW 4 122950457 missense probably benign 0.01
R6736:Mfsd2a UTSW 4 122951261 missense probably benign
R6793:Mfsd2a UTSW 4 122950705 missense probably benign 0.02
R7073:Mfsd2a UTSW 4 122951295 missense possibly damaging 0.91
R7255:Mfsd2a UTSW 4 122952021 missense possibly damaging 0.66
R7382:Mfsd2a UTSW 4 122952123 missense possibly damaging 0.53
R7868:Mfsd2a UTSW 4 122956855 missense possibly damaging 0.93
R8095:Mfsd2a UTSW 4 122951271 missense probably damaging 1.00
R8136:Mfsd2a UTSW 4 122951867 missense probably benign 0.27
R8140:Mfsd2a UTSW 4 122949298 missense probably benign 0.00
R8832:Mfsd2a UTSW 4 122949309 missense probably benign 0.01
R8842:Mfsd2a UTSW 4 122951830 missense probably damaging 0.98
R9048:Mfsd2a UTSW 4 122960975 missense probably benign
R9084:Mfsd2a UTSW 4 122950201 missense probably damaging 1.00
Z1176:Mfsd2a UTSW 4 122951839 missense probably benign 0.44
Z1176:Mfsd2a UTSW 4 122959311 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ATCACCGTATCAGGCAGACC -3'
(R):5'- TCACCATCCCTATCTGGCAG -3'

Sequencing Primer
(F):5'- GTATCAGGCAGACCCACCTC -3'
(R):5'- ATCTGGCAGTGGTTCCTAAC -3'
Posted On 2018-04-02