Incidental Mutation 'R6321:Scarb1'
ID510338
Institutional Source Beutler Lab
Gene Symbol Scarb1
Ensembl Gene ENSMUSG00000037936
Gene Namescavenger receptor class B, member 1
SynonymsCd36l1, Srb1, Hdlq1, SRBI, Hlb398, Cla-1, SR-BI, D5Ertd460e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6321 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location125277087-125341094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125304331 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 50 (S50C)
Ref Sequence ENSEMBL: ENSMUSP00000107021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086075] [ENSMUST00000111390] [ENSMUST00000137783]
Predicted Effect probably damaging
Transcript: ENSMUST00000086075
AA Change: S50C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083242
Gene: ENSMUSG00000037936
AA Change: S50C

DomainStartEndE-ValueType
Pfam:CD36 16 463 6.4e-154 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111390
AA Change: S50C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107021
Gene: ENSMUSG00000037936
AA Change: S50C

DomainStartEndE-ValueType
Pfam:CD36 14 465 4.7e-158 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133624
Predicted Effect unknown
Transcript: ENSMUST00000137783
AA Change: Q38L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156532
Meta Mutation Damage Score 0.7264 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma membrane receptor for high density lipoprotein cholesterol (HDL). The encoded protein mediates cholesterol transfer to and from HDL. In addition, this protein is a receptor for hepatitis C virus glycoprotein E2. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Targeted mutations result in abnormal lipoprotein metablolism and, for one allele, reversible female infertility. An ENU mutant shows increased cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,257,006 probably null Het
Actbl2 G T 13: 111,255,381 M83I probably damaging Het
Adgra2 T A 8: 27,114,162 M460K probably benign Het
Aldh16a1 G A 7: 45,149,765 A31V probably damaging Het
Ank2 T C 3: 126,946,938 probably benign Het
Arrdc4 C A 7: 68,749,045 D8Y probably benign Het
Auts2 A G 5: 131,466,115 Y110H probably damaging Het
Blnk A T 19: 40,934,459 Y405N probably damaging Het
Capsl T C 15: 9,461,769 F84L probably damaging Het
Cenpl T C 1: 161,074,895 S46P probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chrnd C T 1: 87,192,229 R90C probably damaging Het
Cyfip2 A T 11: 46,291,520 M37K probably benign Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Dnah5 T G 15: 28,372,411 V2936G probably damaging Het
Dock9 A G 14: 121,546,021 M2055T probably damaging Het
Epb41l2 A T 10: 25,468,128 R274S probably damaging Het
Erich3 A T 3: 154,727,502 H371L probably damaging Het
Evi5l C A 8: 4,203,080 P454T probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Golgb1 T A 16: 36,918,197 C2299* probably null Het
Heca G C 10: 17,915,243 probably null Het
Hecw1 C T 13: 14,522,829 A9T probably benign Het
Hs3st6 T A 17: 24,758,568 W341R probably damaging Het
Kidins220 C T 12: 25,057,534 S1571L probably benign Het
Klk9 A G 7: 43,794,308 E82G probably damaging Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Mecom A G 3: 29,980,592 Y502H probably damaging Het
Mfsd2a A G 4: 122,949,372 V372A probably benign Het
Mrgprd A G 7: 145,322,142 D250G probably benign Het
Muc2 A G 7: 141,700,828 D191G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr1312 A G 2: 112,042,768 V88A probably benign Het
Olfr692 A G 7: 105,368,902 Y192C probably damaging Het
Pnpla6 T C 8: 3,544,015 V1342A probably benign Het
Ppp1r9a A G 6: 5,115,151 E789G probably damaging Het
Prkdc A G 16: 15,714,919 T1471A probably benign Het
Slc4a8 C T 15: 100,789,164 T283M probably damaging Het
Smc2 C A 4: 52,462,814 D601E probably benign Het
Snx6 C A 12: 54,752,013 V221F probably damaging Het
Spag17 A C 3: 100,088,427 K1794T probably benign Het
Tpo A G 12: 30,103,108 W416R probably damaging Het
Ttc13 C A 8: 124,683,191 K427N probably damaging Het
Upf3a A T 8: 13,787,466 N137I possibly damaging Het
Ush2a C T 1: 188,849,046 Q3708* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp451 A G 1: 33,813,735 F33L probably damaging Het
Zfp454 A G 11: 50,873,049 F408L probably damaging Het
Zfp639 T C 3: 32,517,088 Y40H probably damaging Het
Other mutations in Scarb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03355:Scarb1 APN 5 125289702 missense probably benign 0.01
IGL03052:Scarb1 UTSW 5 125294099 missense probably damaging 1.00
R0051:Scarb1 UTSW 5 125281100 splice site probably null
R0317:Scarb1 UTSW 5 125289692 missense probably damaging 0.99
R0455:Scarb1 UTSW 5 125289681 missense probably damaging 0.96
R0491:Scarb1 UTSW 5 125298731 unclassified probably benign
R0655:Scarb1 UTSW 5 125300440 missense probably damaging 1.00
R0676:Scarb1 UTSW 5 125297214 unclassified probably benign
R2074:Scarb1 UTSW 5 125294143 missense probably benign
R2267:Scarb1 UTSW 5 125287375 missense possibly damaging 0.82
R3951:Scarb1 UTSW 5 125287411 missense probably damaging 0.99
R4080:Scarb1 UTSW 5 125277795 missense probably damaging 1.00
R4452:Scarb1 UTSW 5 125300345 missense probably damaging 1.00
R4925:Scarb1 UTSW 5 125297299 missense probably damaging 1.00
R5669:Scarb1 UTSW 5 125300387 missense probably damaging 1.00
R5809:Scarb1 UTSW 5 125304222 missense probably damaging 0.98
R5872:Scarb1 UTSW 5 125304277 missense possibly damaging 0.60
R5883:Scarb1 UTSW 5 125340907 unclassified probably benign
R6508:Scarb1 UTSW 5 125304325 missense possibly damaging 0.49
R6618:Scarb1 UTSW 5 125304330 missense probably damaging 0.96
R6931:Scarb1 UTSW 5 125284719 missense probably damaging 1.00
R7058:Scarb1 UTSW 5 125297230 missense probably damaging 1.00
R7099:Scarb1 UTSW 5 125304350 missense probably damaging 0.98
R7146:Scarb1 UTSW 5 125284025 missense probably benign
R7830:Scarb1 UTSW 5 125287383 missense probably damaging 1.00
R7873:Scarb1 UTSW 5 125294039 missense probably damaging 1.00
R7956:Scarb1 UTSW 5 125294039 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAAACTCAGCATGGCAG -3'
(R):5'- AAGACACGCCTCTTCCTCCG -3'

Sequencing Primer
(F):5'- TCAGCATGGCAGAACACC -3'
(R):5'- GCTAAGCTGCAAATATCTGAGCCTG -3'
Posted On2018-04-02