Incidental Mutation 'R6321:Klk9'
ID 510342
Institutional Source Beutler Lab
Gene Symbol Klk9
Ensembl Gene ENSMUSG00000047884
Gene Name kallikrein related-peptidase 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6321 (G1)
Quality Score 199.009
Status Validated
Chromosome 7
Chromosomal Location 43791891-43796757 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43794308 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 82 (E82G)
Ref Sequence ENSEMBL: ENSMUSP00000005891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005891] [ENSMUST00000085461] [ENSMUST00000205537]
AlphaFold Q32M27
Predicted Effect probably damaging
Transcript: ENSMUST00000005891
AA Change: E82G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005891
Gene: ENSMUSG00000047884
AA Change: E82G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Tryp_SPc 22 244 1.66e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085461
SMART Domains Protein: ENSMUSP00000082588
Gene: ENSMUSG00000064023

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 32 252 8.87e-99 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205527
Predicted Effect probably benign
Transcript: ENSMUST00000205537
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kallikrein-related serine protease. This gene is activated by steroid hormones in a human breast cancer cell line, making it a good marker for cancer detection. The encoded protein is found primarily in the cytoplasm.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,257,006 probably null Het
Actbl2 G T 13: 111,255,381 M83I probably damaging Het
Adgra2 T A 8: 27,114,162 M460K probably benign Het
Aldh16a1 G A 7: 45,149,765 A31V probably damaging Het
Ank2 T C 3: 126,946,938 probably benign Het
Arrdc4 C A 7: 68,749,045 D8Y probably benign Het
Auts2 A G 5: 131,466,115 Y110H probably damaging Het
Blnk A T 19: 40,934,459 Y405N probably damaging Het
Capsl T C 15: 9,461,769 F84L probably damaging Het
Cenpl T C 1: 161,074,895 S46P probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chrnd C T 1: 87,192,229 R90C probably damaging Het
Cyfip2 A T 11: 46,291,520 M37K probably benign Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Dnah5 T G 15: 28,372,411 V2936G probably damaging Het
Dock9 A G 14: 121,546,021 M2055T probably damaging Het
Epb41l2 A T 10: 25,468,128 R274S probably damaging Het
Erich3 A T 3: 154,727,502 H371L probably damaging Het
Evi5l C A 8: 4,203,080 P454T probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Golgb1 T A 16: 36,918,197 C2299* probably null Het
Heca G C 10: 17,915,243 probably null Het
Hecw1 C T 13: 14,522,829 A9T probably benign Het
Hs3st6 T A 17: 24,758,568 W341R probably damaging Het
Kidins220 C T 12: 25,057,534 S1571L probably benign Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Mecom A G 3: 29,980,592 Y502H probably damaging Het
Mfsd2a A G 4: 122,949,372 V372A probably benign Het
Mrgprd A G 7: 145,322,142 D250G probably benign Het
Muc2 A G 7: 141,700,828 D191G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr1312 A G 2: 112,042,768 V88A probably benign Het
Olfr692 A G 7: 105,368,902 Y192C probably damaging Het
Pnpla6 T C 8: 3,544,015 V1342A probably benign Het
Ppp1r9a A G 6: 5,115,151 E789G probably damaging Het
Prkdc A G 16: 15,714,919 T1471A probably benign Het
Scarb1 T A 5: 125,304,331 S50C probably damaging Het
Slc4a8 C T 15: 100,789,164 T283M probably damaging Het
Smc2 C A 4: 52,462,814 D601E probably benign Het
Snx6 C A 12: 54,752,013 V221F probably damaging Het
Spag17 A C 3: 100,088,427 K1794T probably benign Het
Tpo A G 12: 30,103,108 W416R probably damaging Het
Ttc13 C A 8: 124,683,191 K427N probably damaging Het
Upf3a A T 8: 13,787,466 N137I possibly damaging Het
Ush2a C T 1: 188,849,046 Q3708* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp451 A G 1: 33,813,735 F33L probably damaging Het
Zfp454 A G 11: 50,873,049 F408L probably damaging Het
Zfp639 T C 3: 32,517,088 Y40H probably damaging Het
Other mutations in Klk9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Klk9 APN 7 43792251 missense probably damaging 1.00
IGL02506:Klk9 APN 7 43795639 missense probably benign 0.33
R0452:Klk9 UTSW 7 43794251 unclassified probably benign
R0562:Klk9 UTSW 7 43795666 missense probably damaging 1.00
R1171:Klk9 UTSW 7 43794393 missense possibly damaging 0.82
R4385:Klk9 UTSW 7 43794275 missense probably benign 0.06
R5011:Klk9 UTSW 7 43795995 missense probably damaging 1.00
R5013:Klk9 UTSW 7 43795995 missense probably damaging 1.00
R7652:Klk9 UTSW 7 43796090 missense probably benign 0.43
R8878:Klk9 UTSW 7 43794358 missense possibly damaging 0.92
Z1088:Klk9 UTSW 7 43794311 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCTATGTCACCAGTGGG -3'
(R):5'- TTGGAGCTTGACACACTGCC -3'

Sequencing Primer
(F):5'- AAGAAGGTGGCTGATTTGGG -3'
(R):5'- TGCCCCAGCCAGAGATAAGG -3'
Posted On 2018-04-02