Incidental Mutation 'R6321:Olfr692'
ID510345
Institutional Source Beutler Lab
Gene Symbol Olfr692
Ensembl Gene ENSMUSG00000073906
Gene Nameolfactory receptor 692
SynonymsGA_x6K02T2PBJ9-7994144-7995106, MOR36-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R6321 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105368230-105369355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105368902 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 192 (Y192C)
Ref Sequence ENSEMBL: ENSMUSP00000151295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098152] [ENSMUST00000179474] [ENSMUST00000217827]
Predicted Effect probably damaging
Transcript: ENSMUST00000098152
AA Change: Y183C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095755
Gene: ENSMUSG00000073906
AA Change: Y183C

DomainStartEndE-ValueType
Pfam:7tm_4 45 325 1.3e-90 PFAM
Pfam:7TM_GPCR_Srsx 49 233 1.3e-7 PFAM
Pfam:7tm_1 55 307 3.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179474
SMART Domains Protein: ENSMUSP00000137163
Gene: ENSMUSG00000044465

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 4.2e-98 PFAM
low complexity region 496 515 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
low complexity region 711 724 N/A INTRINSIC
low complexity region 732 744 N/A INTRINSIC
low complexity region 905 920 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217827
AA Change: Y192C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8847 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,257,006 probably null Het
Actbl2 G T 13: 111,255,381 M83I probably damaging Het
Adgra2 T A 8: 27,114,162 M460K probably benign Het
Aldh16a1 G A 7: 45,149,765 A31V probably damaging Het
Ank2 T C 3: 126,946,938 probably benign Het
Arrdc4 C A 7: 68,749,045 D8Y probably benign Het
Auts2 A G 5: 131,466,115 Y110H probably damaging Het
Blnk A T 19: 40,934,459 Y405N probably damaging Het
Capsl T C 15: 9,461,769 F84L probably damaging Het
Cenpl T C 1: 161,074,895 S46P probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chrnd C T 1: 87,192,229 R90C probably damaging Het
Cyfip2 A T 11: 46,291,520 M37K probably benign Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Dnah5 T G 15: 28,372,411 V2936G probably damaging Het
Dock9 A G 14: 121,546,021 M2055T probably damaging Het
Epb41l2 A T 10: 25,468,128 R274S probably damaging Het
Erich3 A T 3: 154,727,502 H371L probably damaging Het
Evi5l C A 8: 4,203,080 P454T probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Golgb1 T A 16: 36,918,197 C2299* probably null Het
Heca G C 10: 17,915,243 probably null Het
Hecw1 C T 13: 14,522,829 A9T probably benign Het
Hs3st6 T A 17: 24,758,568 W341R probably damaging Het
Kidins220 C T 12: 25,057,534 S1571L probably benign Het
Klk9 A G 7: 43,794,308 E82G probably damaging Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Mecom A G 3: 29,980,592 Y502H probably damaging Het
Mfsd2a A G 4: 122,949,372 V372A probably benign Het
Mrgprd A G 7: 145,322,142 D250G probably benign Het
Muc2 A G 7: 141,700,828 D191G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr1312 A G 2: 112,042,768 V88A probably benign Het
Pnpla6 T C 8: 3,544,015 V1342A probably benign Het
Ppp1r9a A G 6: 5,115,151 E789G probably damaging Het
Prkdc A G 16: 15,714,919 T1471A probably benign Het
Scarb1 T A 5: 125,304,331 S50C probably damaging Het
Slc4a8 C T 15: 100,789,164 T283M probably damaging Het
Smc2 C A 4: 52,462,814 D601E probably benign Het
Snx6 C A 12: 54,752,013 V221F probably damaging Het
Spag17 A C 3: 100,088,427 K1794T probably benign Het
Tpo A G 12: 30,103,108 W416R probably damaging Het
Ttc13 C A 8: 124,683,191 K427N probably damaging Het
Upf3a A T 8: 13,787,466 N137I possibly damaging Het
Ush2a C T 1: 188,849,046 Q3708* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp451 A G 1: 33,813,735 F33L probably damaging Het
Zfp454 A G 11: 50,873,049 F408L probably damaging Het
Zfp639 T C 3: 32,517,088 Y40H probably damaging Het
Other mutations in Olfr692
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Olfr692 APN 7 105369247 missense probably damaging 1.00
IGL01772:Olfr692 APN 7 105368434 missense probably benign 0.03
IGL02508:Olfr692 APN 7 105368536 missense possibly damaging 0.95
IGL03103:Olfr692 APN 7 105368578 missense probably damaging 1.00
R1147:Olfr692 UTSW 7 105369277 missense probably benign 0.14
R1147:Olfr692 UTSW 7 105369277 missense probably benign 0.14
R5237:Olfr692 UTSW 7 105369306 nonsense probably null
R5294:Olfr692 UTSW 7 105368413 missense probably benign 0.41
R5955:Olfr692 UTSW 7 105368569 missense probably damaging 1.00
R7171:Olfr692 UTSW 7 105368761 missense probably benign 0.02
R7284:Olfr692 UTSW 7 105368545 missense probably damaging 0.98
R8376:Olfr692 UTSW 7 105368640 missense probably benign 0.33
R8516:Olfr692 UTSW 7 105368769 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGACTGCTATGGAATCTGGTG -3'
(R):5'- GTACCAAAGGCCTTTACTCGG -3'

Sequencing Primer
(F):5'- CATGGCCTGTGATCGGG -3'
(R):5'- TTTACTCGGGCCTCCTGGG -3'
Posted On2018-04-02