Mutagenetix > Incidental Mutations

Incidental Mutation 'R6321:5430419D17Rik'

510346

Institutional Source

Beutler Lab

Gene Symbol

5430419D17Rik

Ensembl Gene

ENSMUSG00000006204

Gene Name

RIKEN cDNA 5430419D17 gene

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6321 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

131174402-131306451 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 131257006 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000150784 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124096] [ENSMUST00000208921]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000124096

SMART Domains

Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	118	4.8e-19	PFAM
Pfam:Pkinase_Tyr	1	118	1.7e-50	PFAM
low complexity region	146	160	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000208921

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

100% (52/52)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actbl2	G	T	13: 111,255,381	M83I	probably damaging	Het
Adgra2	T	A	8: 27,114,162	M460K	probably benign	Het
Aldh16a1	G	A	7: 45,149,765	A31V	probably damaging	Het
Ank2	T	C	3: 126,946,938		probably benign	Het
Arrdc4	C	A	7: 68,749,045	D8Y	probably benign	Het
Auts2	A	G	5: 131,466,115	Y110H	probably damaging	Het
Blnk	A	T	19: 40,934,459	Y405N	probably damaging	Het
Capsl	T	C	15: 9,461,769	F84L	probably damaging	Het
Cenpl	T	C	1: 161,074,895	S46P	probably benign	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Chrnd	C	T	1: 87,192,229	R90C	probably damaging	Het
Cyfip2	A	T	11: 46,291,520	M37K	probably benign	Het
Dnah11	T	C	12: 118,142,292	E625G	possibly damaging	Het
Dnah5	T	G	15: 28,372,411	V2936G	probably damaging	Het
Dock9	A	G	14: 121,546,021	M2055T	probably damaging	Het
Epb41l2	A	T	10: 25,468,128	R274S	probably damaging	Het
Erich3	A	T	3: 154,727,502	H371L	probably damaging	Het
Evi5l	C	A	8: 4,203,080	P454T	probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Golgb1	T	A	16: 36,918,197	C2299*	probably null	Het
Heca	G	C	10: 17,915,243		probably null	Het
Hecw1	C	T	13: 14,522,829	A9T	probably benign	Het
Hs3st6	T	A	17: 24,758,568	W341R	probably damaging	Het
Kidins220	C	T	12: 25,057,534	S1571L	probably benign	Het
Klk9	A	G	7: 43,794,308	E82G	probably damaging	Het
Ltbp3	C	A	19: 5,745,657	H180Q	probably benign	Het
Mecom	A	G	3: 29,980,592	Y502H	probably damaging	Het
Mfsd2a	A	G	4: 122,949,372	V372A	probably benign	Het
Mrgprd	A	G	7: 145,322,142	D250G	probably benign	Het
Muc2	A	G	7: 141,700,828	D191G	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naip6	C	A	13: 100,300,401	S538I	probably benign	Het
Olfr1312	A	G	2: 112,042,768	V88A	probably benign	Het
Olfr692	A	G	7: 105,368,902	Y192C	probably damaging	Het
Pnpla6	T	C	8: 3,544,015	V1342A	probably benign	Het
Ppp1r9a	A	G	6: 5,115,151	E789G	probably damaging	Het
Prkdc	A	G	16: 15,714,919	T1471A	probably benign	Het
Scarb1	T	A	5: 125,304,331	S50C	probably damaging	Het
Slc4a8	C	T	15: 100,789,164	T283M	probably damaging	Het
Smc2	C	A	4: 52,462,814	D601E	probably benign	Het
Snx6	C	A	12: 54,752,013	V221F	probably damaging	Het
Spag17	A	C	3: 100,088,427	K1794T	probably benign	Het
Tpo	A	G	12: 30,103,108	W416R	probably damaging	Het
Ttc13	C	A	8: 124,683,191	K427N	probably damaging	Het
Upf3a	A	T	8: 13,787,466	N137I	possibly damaging	Het
Ush2a	C	T	1: 188,849,046	Q3708*	probably null	Het
Zbtb17	G	A	4: 141,463,383	G171S	probably benign	Het
Zfp451	A	G	1: 33,813,735	F33L	probably damaging	Het
Zfp454	A	G	11: 50,873,049	F408L	probably damaging	Het
Zfp639	T	C	3: 32,517,088	Y40H	probably damaging	Het

Other mutations in 5430419D17Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:5430419D17Rik	APN	7	131238094	splice site	probably null
IGL00848:5430419D17Rik	APN	7	131246724	missense	probably damaging	1.00
IGL00966:5430419D17Rik	APN	7	131243107	nonsense	probably null
IGL01286:5430419D17Rik	APN	7	131246703	missense	probably damaging	1.00
IGL01303:5430419D17Rik	APN	7	131194331	missense	possibly damaging	0.53
IGL01585:5430419D17Rik	APN	7	131244758	missense	probably damaging	0.97
IGL01665:5430419D17Rik	APN	7	131246657	nonsense	probably null
IGL01953:5430419D17Rik	APN	7	131224980	missense	probably benign	0.04
IGL02427:5430419D17Rik	APN	7	131244788	missense	probably damaging	0.99
IGL02508:5430419D17Rik	APN	7	131222830	missense	probably damaging	1.00
IGL02678:5430419D17Rik	APN	7	131228917	missense	probably damaging	1.00
IGL03092:5430419D17Rik	APN	7	131201798	critical splice donor site	probably null
IGL03122:5430419D17Rik	APN	7	131196514	missense	possibly damaging	0.68
IGL03343:5430419D17Rik	APN	7	131246691	missense	probably damaging	1.00
R0011:5430419D17Rik	UTSW	7	131229993	missense	probably damaging	0.99
R0011:5430419D17Rik	UTSW	7	131229993	missense	probably damaging	0.99
R0234:5430419D17Rik	UTSW	7	131194303	splice site	probably null
R0234:5430419D17Rik	UTSW	7	131194303	splice site	probably null
R0268:5430419D17Rik	UTSW	7	131238176	missense	probably damaging	1.00
R0383:5430419D17Rik	UTSW	7	131239539	missense	probably benign	0.05
R0973:5430419D17Rik	UTSW	7	131238182	missense	probably damaging	1.00
R0973:5430419D17Rik	UTSW	7	131238182	missense	probably damaging	1.00
R0974:5430419D17Rik	UTSW	7	131238182	missense	probably damaging	1.00
R1572:5430419D17Rik	UTSW	7	131244831	nonsense	probably null
R1911:5430419D17Rik	UTSW	7	131238089	missense	probably damaging	1.00
R2032:5430419D17Rik	UTSW	7	131243052	missense	probably damaging	1.00
R2097:5430419D17Rik	UTSW	7	131181964	nonsense	probably null
R2221:5430419D17Rik	UTSW	7	131247457	critical splice acceptor site	probably null
R2223:5430419D17Rik	UTSW	7	131247457	critical splice acceptor site	probably null
R2254:5430419D17Rik	UTSW	7	131222905	missense	probably damaging	1.00
R2913:5430419D17Rik	UTSW	7	131182024	missense	possibly damaging	0.90
R2991:5430419D17Rik	UTSW	7	131246700	missense	probably damaging	1.00
R3439:5430419D17Rik	UTSW	7	131188779	critical splice donor site	probably null
R4418:5430419D17Rik	UTSW	7	131247465	missense	possibly damaging	0.86
R4916:5430419D17Rik	UTSW	7	131174477	splice site	probably null
R5488:5430419D17Rik	UTSW	7	131246595	missense	probably damaging	1.00
R5594:5430419D17Rik	UTSW	7	131239523	missense	probably benign	0.12
R5897:5430419D17Rik	UTSW	7	131196551	splice site	probably null
R5898:5430419D17Rik	UTSW	7	131241967	splice site	probably null
R5940:5430419D17Rik	UTSW	7	131238263	missense	probably damaging	1.00
R6170:5430419D17Rik	UTSW	7	131174487	splice site	probably null
R6187:5430419D17Rik	UTSW	7	131270599	intron	probably benign
R6409:5430419D17Rik	UTSW	7	131262071	intron	probably benign
R6432:5430419D17Rik	UTSW	7	131244872	critical splice donor site	probably null
R6481:5430419D17Rik	UTSW	7	131256801	missense	probably benign	0.05
R6750:5430419D17Rik	UTSW	7	131288245	intron	probably benign
R6783:5430419D17Rik	UTSW	7	131226764	missense	probably damaging	0.99
R6836:5430419D17Rik	UTSW	7	131196504	missense	possibly damaging	0.84
R6925:5430419D17Rik	UTSW	7	131222707	missense	possibly damaging	0.92
R6995:5430419D17Rik	UTSW	7	131222671	missense	probably damaging	1.00
R7199:5430419D17Rik	UTSW	7	131235912	nonsense	probably null
R7205:5430419D17Rik	UTSW	7	131277623	critical splice donor site	probably null
R7340:5430419D17Rik	UTSW	7	131277615	missense	unknown
R7354:5430419D17Rik	UTSW	7	131256729	missense	possibly damaging	0.84
R7354:5430419D17Rik	UTSW	7	131272033	missense	unknown
R7434:5430419D17Rik	UTSW	7	131279483	missense	unknown
R7485:5430419D17Rik	UTSW	7	131228833	missense	probably damaging	0.99
R7513:5430419D17Rik	UTSW	7	131272071	missense	unknown
R7562:5430419D17Rik	UTSW	7	131302697	missense	unknown
R7623:5430419D17Rik	UTSW	7	131277566	splice site	probably null
R7782:5430419D17Rik	UTSW	7	131302737	splice site	probably null
R7879:5430419D17Rik	UTSW	7	131243142	missense	probably damaging	0.98
R7935:5430419D17Rik	UTSW	7	131250476	missense	probably damaging	0.96
R7949:5430419D17Rik	UTSW	7	131293595	splice site	probably null
R7964:5430419D17Rik	UTSW	7	131298234	missense	unknown
R7980:5430419D17Rik	UTSW	7	131234777	missense	probably damaging	0.98
R8145:5430419D17Rik	UTSW	7	131296316	missense	unknown
R8673:5430419D17Rik	UTSW	7	131243117	missense	probably damaging	0.99
R8684:5430419D17Rik	UTSW	7	131235959	nonsense	probably null
R8721:5430419D17Rik	UTSW	7	131277606	missense	unknown
R8725:5430419D17Rik	UTSW	7	131273756	missense	unknown
R8727:5430419D17Rik	UTSW	7	131273756	missense	unknown
R8742:5430419D17Rik	UTSW	7	131182012	missense	unknown
R8807:5430419D17Rik	UTSW	7	131244778	missense	probably damaging	0.97
R8822:5430419D17Rik	UTSW	7	131241977	critical splice acceptor site	probably null
R8861:5430419D17Rik	UTSW	7	131259961	nonsense	probably null
R8897:5430419D17Rik	UTSW	7	131265837	missense	unknown
R8900:5430419D17Rik	UTSW	7	131302468	intron	probably benign
R9214:5430419D17Rik	UTSW	7	131222752	missense	possibly damaging	0.89
R9218:5430419D17Rik	UTSW	7	131261999	missense	unknown
R9311:5430419D17Rik	UTSW	7	131257761	missense	unknown
R9323:5430419D17Rik	UTSW	7	131226672	missense	probably damaging	0.96
R9384:5430419D17Rik	UTSW	7	131302675	missense	unknown
R9387:5430419D17Rik	UTSW	7	131261891	missense	unknown
R9417:5430419D17Rik	UTSW	7	131250489	missense	possibly damaging	0.60
Z1088:5430419D17Rik	UTSW	7	131246633	missense	probably damaging	1.00
Z1177:5430419D17Rik	UTSW	7	131265866	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGCTGGGATCTGACAGATGC -3'
(R):5'- CCCTTTACAAATGACTGAACCTAAG -3'

Sequencing Primer
(F):5'- TCTGACAGATGCCAAGGTG -3'
(R):5'- GACTGAACCTAAGGTTGAAAACTAAC -3'

Posted On

2018-04-02