Incidental Mutation 'R6321:Muc2'
ID 510347
Institutional Source Beutler Lab
Gene Symbol Muc2
Ensembl Gene ENSMUSG00000025515
Gene Name mucin 2
Synonyms 2010015E03Rik
MMRRC Submission
Accession Numbers

Genbank: BC034197; MGI: 1339364

Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R6321 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 141690340-141754693 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 141700828 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 191 (D191G)
Ref Sequence ENSEMBL: ENSMUSP00000128250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000179227] [ENSMUST00000185406] [ENSMUST00000185823]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000167366
AA Change: D191G

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515
AA Change: D191G

DomainStartEndE-ValueType
Pfam:VWD 3 72 2.3e-14 PFAM
C8 107 181 1.82e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179227
SMART Domains Protein: ENSMUSP00000136692
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
C8 11 85 1.61e-32 SMART
Blast:VWD 102 128 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000185406
SMART Domains Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
VWD 20 183 1.5e-40 SMART
C8 216 290 3.9e-15 SMART
Pfam:TIL 293 349 5.4e-10 PFAM
VWC 351 411 7e-4 SMART
VWD 378 542 8.8e-44 SMART
C8 579 653 1.2e-36 SMART
SCOP:d1coua_ 654 728 4e-8 SMART
VWC_def 820 865 1.3e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185823
AA Change: D192G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515
AA Change: D192G

DomainStartEndE-ValueType
Pfam:VWD 3 73 5.6e-14 PFAM
C8 108 182 1.4e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187789
Predicted Effect probably benign
Transcript: ENSMUST00000191587
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,257,006 probably null Het
Actbl2 G T 13: 111,255,381 M83I probably damaging Het
Adgra2 T A 8: 27,114,162 M460K probably benign Het
Aldh16a1 G A 7: 45,149,765 A31V probably damaging Het
Ank2 T C 3: 126,946,938 probably benign Het
Arrdc4 C A 7: 68,749,045 D8Y probably benign Het
Auts2 A G 5: 131,466,115 Y110H probably damaging Het
Blnk A T 19: 40,934,459 Y405N probably damaging Het
Capsl T C 15: 9,461,769 F84L probably damaging Het
Cenpl T C 1: 161,074,895 S46P probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chrnd C T 1: 87,192,229 R90C probably damaging Het
Cyfip2 A T 11: 46,291,520 M37K probably benign Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Dnah5 T G 15: 28,372,411 V2936G probably damaging Het
Dock9 A G 14: 121,546,021 M2055T probably damaging Het
Epb41l2 A T 10: 25,468,128 R274S probably damaging Het
Erich3 A T 3: 154,727,502 H371L probably damaging Het
Evi5l C A 8: 4,203,080 P454T probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Golgb1 T A 16: 36,918,197 C2299* probably null Het
Heca G C 10: 17,915,243 probably null Het
Hecw1 C T 13: 14,522,829 A9T probably benign Het
Hs3st6 T A 17: 24,758,568 W341R probably damaging Het
Kidins220 C T 12: 25,057,534 S1571L probably benign Het
Klk9 A G 7: 43,794,308 E82G probably damaging Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Mecom A G 3: 29,980,592 Y502H probably damaging Het
Mfsd2a A G 4: 122,949,372 V372A probably benign Het
Mrgprd A G 7: 145,322,142 D250G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr1312 A G 2: 112,042,768 V88A probably benign Het
Olfr692 A G 7: 105,368,902 Y192C probably damaging Het
Pnpla6 T C 8: 3,544,015 V1342A probably benign Het
Ppp1r9a A G 6: 5,115,151 E789G probably damaging Het
Prkdc A G 16: 15,714,919 T1471A probably benign Het
Scarb1 T A 5: 125,304,331 S50C probably damaging Het
Slc4a8 C T 15: 100,789,164 T283M probably damaging Het
Smc2 C A 4: 52,462,814 D601E probably benign Het
Snx6 C A 12: 54,752,013 V221F probably damaging Het
Spag17 A C 3: 100,088,427 K1794T probably benign Het
Tpo A G 12: 30,103,108 W416R probably damaging Het
Ttc13 C A 8: 124,683,191 K427N probably damaging Het
Upf3a A T 8: 13,787,466 N137I possibly damaging Het
Ush2a C T 1: 188,849,046 Q3708* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp451 A G 1: 33,813,735 F33L probably damaging Het
Zfp454 A G 11: 50,873,049 F408L probably damaging Het
Zfp639 T C 3: 32,517,088 Y40H probably damaging Het
Other mutations in Muc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Eeyore APN 7 141693356 missense probably benign 0.35
kenny APN 7 nonsense
Winnie APN 7 141699460 missense probably damaging 1.00
IGL01303:Muc2 APN 7 141752395 missense probably benign
IGL01482:Muc2 APN 7 141754060 missense probably damaging 0.96
IGL01875:Muc2 APN 7 141752740 missense probably damaging 0.99
IGL02088:Muc2 APN 7 141751504 missense probably damaging 1.00
IGL02415:Muc2 APN 7 141751872 nonsense probably null
IGL02548:Muc2 APN 7 141751857 missense probably damaging 1.00
IGL02836:Muc2 APN 7 141746713 unclassified probably benign
IGL03196:Muc2 APN 7 141747630 missense probably damaging 0.97
Muskatenwein UTSW 7 141753439 missense unknown
nomoco UTSW 7 141753719 missense probably damaging 1.00
Schlendrian UTSW 7 141695682 missense probably damaging 1.00
Seco UTSW 7 141698733 missense probably damaging 1.00
BB001:Muc2 UTSW 7 141695388 missense probably damaging 1.00
BB011:Muc2 UTSW 7 141695388 missense probably damaging 1.00
E0370:Muc2 UTSW 7 141696355 missense probably damaging 1.00
R0127:Muc2 UTSW 7 141748954 missense probably benign 0.00
R0179:Muc2 UTSW 7 141748971 missense probably damaging 1.00
R0201:Muc2 UTSW 7 141699185 frame shift probably null
R0299:Muc2 UTSW 7 141752729 missense probably damaging 1.00
R0547:Muc2 UTSW 7 141699185 frame shift probably null
R0699:Muc2 UTSW 7 141752300 missense probably damaging 1.00
R0900:Muc2 UTSW 7 141699185 frame shift probably null
R1348:Muc2 UTSW 7 141699185 frame shift probably null
R1466:Muc2 UTSW 7 141748974 missense probably damaging 1.00
R1466:Muc2 UTSW 7 141748974 missense probably damaging 1.00
R1625:Muc2 UTSW 7 141697162 missense probably damaging 1.00
R2010:Muc2 UTSW 7 141700875 missense probably damaging 0.99
R2149:Muc2 UTSW 7 141699185 frame shift probably null
R2163:Muc2 UTSW 7 141699185 frame shift probably null
R3008:Muc2 UTSW 7 141695104 missense possibly damaging 0.93
R3110:Muc2 UTSW 7 141745488 unclassified probably benign
R3112:Muc2 UTSW 7 141745488 unclassified probably benign
R3424:Muc2 UTSW 7 141693352 missense probably damaging 0.99
R3786:Muc2 UTSW 7 141697347 missense probably benign 0.01
R3854:Muc2 UTSW 7 141754344 missense probably damaging 1.00
R3964:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3965:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3966:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3973:Muc2 UTSW 7 141746804 unclassified probably benign
R3974:Muc2 UTSW 7 141746804 unclassified probably benign
R3976:Muc2 UTSW 7 141746804 unclassified probably benign
R4327:Muc2 UTSW 7 141695334 missense probably damaging 0.96
R4694:Muc2 UTSW 7 141752345 missense probably damaging 1.00
R4764:Muc2 UTSW 7 141745608 missense possibly damaging 0.88
R4769:Muc2 UTSW 7 141699691 critical splice donor site probably null
R4798:Muc2 UTSW 7 141754140 missense probably benign 0.01
R4900:Muc2 UTSW 7 141749543 missense probably benign 0.32
R5383:Muc2 UTSW 7 141753719 missense probably damaging 1.00
R5489:Muc2 UTSW 7 141751432 missense probably benign 0.00
R5615:Muc2 UTSW 7 141691203 missense probably damaging 1.00
R5856:Muc2 UTSW 7 141745644 unclassified probably benign
R5919:Muc2 UTSW 7 141694928 missense probably damaging 0.97
R5953:Muc2 UTSW 7 141701382 missense probably damaging 0.96
R5979:Muc2 UTSW 7 141697250 splice site probably null
R5979:Muc2 UTSW 7 141751406 missense probably damaging 0.99
R6175:Muc2 UTSW 7 141696632 missense probably damaging 1.00
R6213:Muc2 UTSW 7 141751414 missense probably damaging 1.00
R6281:Muc2 UTSW 7 141752403 missense probably damaging 1.00
R6390:Muc2 UTSW 7 141752146 missense probably damaging 0.97
R6485:Muc2 UTSW 7 141746736 unclassified probably benign
R6582:Muc2 UTSW 7 141696698 missense probably benign 0.00
R6683:Muc2 UTSW 7 141751477 missense probably benign 0.38
R6896:Muc2 UTSW 7 141752695 missense possibly damaging 0.48
R6906:Muc2 UTSW 7 141698733 missense probably damaging 1.00
R6924:Muc2 UTSW 7 141697834 missense possibly damaging 0.87
R7040:Muc2 UTSW 7 141751457 missense unknown
R7222:Muc2 UTSW 7 141704209 missense
R7251:Muc2 UTSW 7 141692722 missense possibly damaging 0.91
R7282:Muc2 UTSW 7 141752744 missense
R7315:Muc2 UTSW 7 141690402 missense probably damaging 0.99
R7421:Muc2 UTSW 7 141748126 missense
R7556:Muc2 UTSW 7 141753702 missense
R7651:Muc2 UTSW 7 141704201 missense
R7710:Muc2 UTSW 7 141700883 missense possibly damaging 0.92
R7776:Muc2 UTSW 7 141704393 missense
R7813:Muc2 UTSW 7 141696300 splice site probably null
R7843:Muc2 UTSW 7 141695419 missense probably benign 0.03
R7869:Muc2 UTSW 7 141749734 missense
R7924:Muc2 UTSW 7 141695388 missense probably damaging 1.00
R7993:Muc2 UTSW 7 141754436 missense
R8053:Muc2 UTSW 7 141698332 missense probably benign 0.01
R8068:Muc2 UTSW 7 141744685 missense
R8099:Muc2 UTSW 7 141745438 splice site probably null
R8192:Muc2 UTSW 7 141751478 missense
R8194:Muc2 UTSW 7 141704252 missense
R8545:Muc2 UTSW 7 141752393 missense unknown
R8701:Muc2 UTSW 7 141695607 missense probably damaging 1.00
R8883:Muc2 UTSW 7 141700900 missense probably damaging 0.98
R8894:Muc2 UTSW 7 141694515 missense probably damaging 1.00
R8905:Muc2 UTSW 7 141693400 missense probably benign 0.00
R9024:Muc2 UTSW 7 141701367 missense probably damaging 0.98
R9032:Muc2 UTSW 7 141700489 missense probably damaging 1.00
R9085:Muc2 UTSW 7 141700489 missense probably damaging 1.00
R9091:Muc2 UTSW 7 141704267 missense
R9104:Muc2 UTSW 7 141699655 missense probably damaging 1.00
R9114:Muc2 UTSW 7 141701414 nonsense probably null
R9270:Muc2 UTSW 7 141704267 missense
R9297:Muc2 UTSW 7 141749022 missense
R9325:Muc2 UTSW 7 141744822 missense
R9354:Muc2 UTSW 7 141753420 missense
R9386:Muc2 UTSW 7 141693146 missense probably damaging 1.00
Z1176:Muc2 UTSW 7 141746714 missense
Z1177:Muc2 UTSW 7 141744794 missense
Predicted Primers PCR Primer
(F):5'- TGTGAACCATTCCATATTTGCC -3'
(R):5'- AAAGTCCCCATGTGTCTCCC -3'

Sequencing Primer
(F):5'- GAACCATTCCATATTTGCCCCCAG -3'
(R):5'- ATGTGTCTCCCCCAACTGGTG -3'
Posted On 2018-04-02