Incidental Mutation 'R6321:Ttc13'
ID510352
Institutional Source Beutler Lab
Gene Symbol Ttc13
Ensembl Gene ENSMUSG00000037300
Gene Nametetratricopeptide repeat domain 13
SynonymsMGC:28881
MMRRC Submission
Accession Numbers

Genbank: NM_145607; MGI: 28881

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6321 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location124671332-124721983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 124683191 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 427 (K427N)
Ref Sequence ENSEMBL: ENSMUSP00000156040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041614] [ENSMUST00000117624] [ENSMUST00000118134] [ENSMUST00000214828] [ENSMUST00000231984]
Predicted Effect probably damaging
Transcript: ENSMUST00000041614
AA Change: K427N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038484
Gene: ENSMUSG00000037300
AA Change: K427N

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:TPR_11 153 204 3e-8 PFAM
Pfam:TPR_19 154 213 5.1e-8 PFAM
Pfam:TPR_1 173 206 6.1e-10 PFAM
Pfam:TPR_2 173 206 1.2e-7 PFAM
Pfam:TPR_8 173 206 5.2e-8 PFAM
Pfam:TPR_16 177 241 6.5e-11 PFAM
Pfam:TPR_9 179 249 3.5e-6 PFAM
Pfam:TPR_11 204 272 2.2e-8 PFAM
Pfam:TPR_1 207 240 3.3e-5 PFAM
Pfam:TPR_2 207 240 1.9e-5 PFAM
Blast:UTG 692 755 4e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000117624
AA Change: K449N

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114043
Gene: ENSMUSG00000037300
AA Change: K449N

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Blast:TPR 128 161 2e-13 BLAST
TPR 162 194 1.08e1 SMART
TPR 195 228 2.24e-7 SMART
TPR 229 262 3.67e-3 SMART
Blast:UTG 714 777 4e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000118134
AA Change: K503N

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113383
Gene: ENSMUSG00000037300
AA Change: K503N

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Blast:TPR 128 156 4e-10 BLAST
TPR 181 214 5.56e-3 SMART
TPR 215 248 1.17e-1 SMART
TPR 249 282 2.24e-7 SMART
TPR 283 316 3.67e-3 SMART
Blast:UTG 768 831 1e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140350
Predicted Effect probably damaging
Transcript: ENSMUST00000214828
AA Change: K556N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000231984
AA Change: K427N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (52/52)
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,257,006 probably null Het
Actbl2 G T 13: 111,255,381 M83I probably damaging Het
Adgra2 T A 8: 27,114,162 M460K probably benign Het
Aldh16a1 G A 7: 45,149,765 A31V probably damaging Het
Ank2 T C 3: 126,946,938 probably benign Het
Arrdc4 C A 7: 68,749,045 D8Y probably benign Het
Auts2 A G 5: 131,466,115 Y110H probably damaging Het
Blnk A T 19: 40,934,459 Y405N probably damaging Het
Capsl T C 15: 9,461,769 F84L probably damaging Het
Cenpl T C 1: 161,074,895 S46P probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chrnd C T 1: 87,192,229 R90C probably damaging Het
Cyfip2 A T 11: 46,291,520 M37K probably benign Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Dnah5 T G 15: 28,372,411 V2936G probably damaging Het
Dock9 A G 14: 121,546,021 M2055T probably damaging Het
Epb41l2 A T 10: 25,468,128 R274S probably damaging Het
Erich3 A T 3: 154,727,502 H371L probably damaging Het
Evi5l C A 8: 4,203,080 P454T probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Golgb1 T A 16: 36,918,197 C2299* probably null Het
Heca G C 10: 17,915,243 probably null Het
Hecw1 C T 13: 14,522,829 A9T probably benign Het
Hs3st6 T A 17: 24,758,568 W341R probably damaging Het
Kidins220 C T 12: 25,057,534 S1571L probably benign Het
Klk9 A G 7: 43,794,308 E82G probably damaging Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Mecom A G 3: 29,980,592 Y502H probably damaging Het
Mfsd2a A G 4: 122,949,372 V372A probably benign Het
Mrgprd A G 7: 145,322,142 D250G probably benign Het
Muc2 A G 7: 141,700,828 D191G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr1312 A G 2: 112,042,768 V88A probably benign Het
Olfr692 A G 7: 105,368,902 Y192C probably damaging Het
Pnpla6 T C 8: 3,544,015 V1342A probably benign Het
Ppp1r9a A G 6: 5,115,151 E789G probably damaging Het
Prkdc A G 16: 15,714,919 T1471A probably benign Het
Scarb1 T A 5: 125,304,331 S50C probably damaging Het
Slc4a8 C T 15: 100,789,164 T283M probably damaging Het
Smc2 C A 4: 52,462,814 D601E probably benign Het
Snx6 C A 12: 54,752,013 V221F probably damaging Het
Spag17 A C 3: 100,088,427 K1794T probably benign Het
Tpo A G 12: 30,103,108 W416R probably damaging Het
Upf3a A T 8: 13,787,466 N137I possibly damaging Het
Ush2a C T 1: 188,849,046 Q3708* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp451 A G 1: 33,813,735 F33L probably damaging Het
Zfp454 A G 11: 50,873,049 F408L probably damaging Het
Zfp639 T C 3: 32,517,088 Y40H probably damaging Het
Other mutations in Ttc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Ttc13 APN 8 124688847 splice site probably benign
IGL01086:Ttc13 APN 8 124675346 missense probably damaging 0.98
IGL01411:Ttc13 APN 8 124683285 missense probably damaging 1.00
IGL01511:Ttc13 APN 8 124676371 missense probably damaging 1.00
IGL01610:Ttc13 APN 8 124676344 missense probably damaging 1.00
IGL01626:Ttc13 APN 8 124673738 splice site probably benign
IGL01967:Ttc13 APN 8 124712647 missense probably damaging 0.99
IGL01995:Ttc13 APN 8 124688882 missense probably damaging 1.00
IGL02456:Ttc13 APN 8 124690361 critical splice acceptor site probably null
IGL02816:Ttc13 APN 8 124712676 missense possibly damaging 0.89
3-1:Ttc13 UTSW 8 124679009 missense possibly damaging 0.81
LCD18:Ttc13 UTSW 8 124675866 intron probably benign
R0126:Ttc13 UTSW 8 124683291 missense probably damaging 0.99
R0391:Ttc13 UTSW 8 124674401 missense probably damaging 1.00
R0602:Ttc13 UTSW 8 124674366 missense probably damaging 0.99
R0629:Ttc13 UTSW 8 124674366 missense probably damaging 0.99
R0638:Ttc13 UTSW 8 124674366 missense probably damaging 0.99
R0714:Ttc13 UTSW 8 124674366 missense probably damaging 0.99
R1981:Ttc13 UTSW 8 124714187 critical splice donor site probably null
R2051:Ttc13 UTSW 8 124672211 splice site probably null
R2324:Ttc13 UTSW 8 124679057 missense probably damaging 1.00
R2404:Ttc13 UTSW 8 124678997 splice site probably benign
R2571:Ttc13 UTSW 8 124683799 missense probably damaging 1.00
R3110:Ttc13 UTSW 8 124683834 missense possibly damaging 0.90
R3112:Ttc13 UTSW 8 124683834 missense possibly damaging 0.90
R4560:Ttc13 UTSW 8 124675277 missense probably damaging 1.00
R4562:Ttc13 UTSW 8 124675277 missense probably damaging 1.00
R4563:Ttc13 UTSW 8 124675277 missense probably damaging 1.00
R4565:Ttc13 UTSW 8 124682087 missense probably damaging 1.00
R4855:Ttc13 UTSW 8 124674435 missense probably damaging 1.00
R4998:Ttc13 UTSW 8 124680056 missense probably damaging 1.00
R5137:Ttc13 UTSW 8 124694935 nonsense probably null
R5397:Ttc13 UTSW 8 124675263 missense possibly damaging 0.94
R5619:Ttc13 UTSW 8 124679944 intron probably benign
R5966:Ttc13 UTSW 8 124682220 intron probably benign
R6092:Ttc13 UTSW 8 124679033 missense probably benign 0.36
R6439:Ttc13 UTSW 8 124673482 missense probably benign 0.02
R6737:Ttc13 UTSW 8 124682161 critical splice acceptor site probably null
R6804:Ttc13 UTSW 8 124699687 missense probably damaging 1.00
R6967:Ttc13 UTSW 8 124688618 missense probably benign 0.17
R7542:Ttc13 UTSW 8 124675103 intron probably null
R7905:Ttc13 UTSW 8 124688596 missense probably benign 0.09
R7988:Ttc13 UTSW 8 124688596 missense probably benign 0.09
X0027:Ttc13 UTSW 8 124673589 missense probably benign
Z1176:Ttc13 UTSW 8 124694842 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTAGCGGGAAATAACTCAGTATCTTAA -3'
(R):5'- CCTTGGAAAGGGTTCTGACGA -3'

Sequencing Primer
(F):5'- GCATGCGAGAACTATTCCTTTGAGTC -3'
(R):5'- AGCTGTCTGGTTGTGTCCTCC -3'
Posted On2018-04-02