Incidental Mutation 'R6321:Heca'
ID 510353
Institutional Source Beutler Lab
Gene Symbol Heca
Ensembl Gene ENSMUSG00000039879
Gene Name hdc homolog, cell cycle regulator
Synonyms LOC380629
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock # R6321 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 17868612-17948067 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to C at 17915243 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000037879]
AlphaFold Q3V1N5
Predicted Effect possibly damaging
Transcript: ENSMUST00000037879
AA Change: T355S

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000040707
Gene: ENSMUSG00000039879
AA Change: T355S

DomainStartEndE-ValueType
SCOP:d1gkub1 29 61 8e-3 SMART
Pfam:HECA 94 192 2.8e-42 PFAM
Pfam:Headcase 335 535 2.8e-86 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218758
Meta Mutation Damage Score 0.1328 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila headcase protein, a highly basic, cytoplasmic protein that regulates the re-entry of imaginal cells into the mitotic cycle during adult morphogenesis. In Drosophila, the encoded protein also inhibits terminal branching of neighboring cells during tracheal development. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,257,006 probably null Het
Actbl2 G T 13: 111,255,381 M83I probably damaging Het
Adgra2 T A 8: 27,114,162 M460K probably benign Het
Aldh16a1 G A 7: 45,149,765 A31V probably damaging Het
Ank2 T C 3: 126,946,938 probably benign Het
Arrdc4 C A 7: 68,749,045 D8Y probably benign Het
Auts2 A G 5: 131,466,115 Y110H probably damaging Het
Blnk A T 19: 40,934,459 Y405N probably damaging Het
Capsl T C 15: 9,461,769 F84L probably damaging Het
Cenpl T C 1: 161,074,895 S46P probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chrnd C T 1: 87,192,229 R90C probably damaging Het
Cyfip2 A T 11: 46,291,520 M37K probably benign Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Dnah5 T G 15: 28,372,411 V2936G probably damaging Het
Dock9 A G 14: 121,546,021 M2055T probably damaging Het
Epb41l2 A T 10: 25,468,128 R274S probably damaging Het
Erich3 A T 3: 154,727,502 H371L probably damaging Het
Evi5l C A 8: 4,203,080 P454T probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Golgb1 T A 16: 36,918,197 C2299* probably null Het
Hecw1 C T 13: 14,522,829 A9T probably benign Het
Hs3st6 T A 17: 24,758,568 W341R probably damaging Het
Kidins220 C T 12: 25,057,534 S1571L probably benign Het
Klk9 A G 7: 43,794,308 E82G probably damaging Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Mecom A G 3: 29,980,592 Y502H probably damaging Het
Mfsd2a A G 4: 122,949,372 V372A probably benign Het
Mrgprd A G 7: 145,322,142 D250G probably benign Het
Muc2 A G 7: 141,700,828 D191G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr1312 A G 2: 112,042,768 V88A probably benign Het
Olfr692 A G 7: 105,368,902 Y192C probably damaging Het
Pnpla6 T C 8: 3,544,015 V1342A probably benign Het
Ppp1r9a A G 6: 5,115,151 E789G probably damaging Het
Prkdc A G 16: 15,714,919 T1471A probably benign Het
Scarb1 T A 5: 125,304,331 S50C probably damaging Het
Slc4a8 C T 15: 100,789,164 T283M probably damaging Het
Smc2 C A 4: 52,462,814 D601E probably benign Het
Snx6 C A 12: 54,752,013 V221F probably damaging Het
Spag17 A C 3: 100,088,427 K1794T probably benign Het
Tpo A G 12: 30,103,108 W416R probably damaging Het
Ttc13 C A 8: 124,683,191 K427N probably damaging Het
Upf3a A T 8: 13,787,466 N137I possibly damaging Het
Ush2a C T 1: 188,849,046 Q3708* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp451 A G 1: 33,813,735 F33L probably damaging Het
Zfp454 A G 11: 50,873,049 F408L probably damaging Het
Zfp639 T C 3: 32,517,088 Y40H probably damaging Het
Other mutations in Heca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Heca APN 10 17915967 missense probably damaging 1.00
IGL01971:Heca APN 10 17915414 missense probably damaging 1.00
E0374:Heca UTSW 10 17908176 missense probably damaging 1.00
R0089:Heca UTSW 10 17908100 missense probably damaging 0.99
R0218:Heca UTSW 10 17915715 missense probably benign 0.22
R0608:Heca UTSW 10 17915291 missense possibly damaging 0.86
R4131:Heca UTSW 10 17902239 missense probably damaging 1.00
R4132:Heca UTSW 10 17902239 missense probably damaging 1.00
R4674:Heca UTSW 10 17915309 missense probably benign 0.30
R4675:Heca UTSW 10 17915309 missense probably benign 0.30
R4736:Heca UTSW 10 17915187 nonsense probably null
R4789:Heca UTSW 10 17908147 nonsense probably null
R4819:Heca UTSW 10 17908072 missense probably damaging 1.00
R5372:Heca UTSW 10 17915139 missense probably damaging 1.00
R5412:Heca UTSW 10 17902296 missense probably damaging 1.00
R5737:Heca UTSW 10 17915714 missense possibly damaging 0.76
R6630:Heca UTSW 10 17908108 nonsense probably null
R7100:Heca UTSW 10 17915373 missense probably benign 0.00
R7381:Heca UTSW 10 17915524 nonsense probably null
R7664:Heca UTSW 10 17902370 missense probably damaging 1.00
R8293:Heca UTSW 10 17902263 missense probably damaging 1.00
R8677:Heca UTSW 10 17915676 missense probably benign 0.10
R8967:Heca UTSW 10 17914990 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTTGAGGGGCTTAAGAACAG -3'
(R):5'- CCTCCAGATACCTTGGGGAATTC -3'

Sequencing Primer
(F):5'- GGGCTTAAGAACAGAGTTCCATCC -3'
(R):5'- CCAGATACCTTGGGGAATTCTTAAAG -3'
Posted On 2018-04-02