Incidental Mutation 'R6321:Zfp454'
ID 510356
Institutional Source Beutler Lab
Gene Symbol Zfp454
Ensembl Gene ENSMUSG00000048728
Gene Name zinc finger protein 454
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R6321 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 50872720-50887651 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 50873049 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 408 (F408L)
Ref Sequence ENSEMBL: ENSMUSP00000104759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050595] [ENSMUST00000109131] [ENSMUST00000125749] [ENSMUST00000163301]
AlphaFold Q80Y34
Predicted Effect probably benign
Transcript: ENSMUST00000050595
AA Change: F519L

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000061824
Gene: ENSMUSG00000048728
AA Change: F519L

DomainStartEndE-ValueType
KRAB 14 75 1.35e-29 SMART
ZnF_C2H2 191 213 9.73e-4 SMART
ZnF_C2H2 230 252 6.32e-3 SMART
ZnF_C2H2 258 280 2.4e-3 SMART
ZnF_C2H2 286 308 8.22e-2 SMART
ZnF_C2H2 314 336 1.33e-1 SMART
ZnF_C2H2 342 364 1.84e-4 SMART
ZnF_C2H2 370 392 9.73e-4 SMART
ZnF_C2H2 398 420 5.21e-4 SMART
ZnF_C2H2 426 448 4.87e-4 SMART
ZnF_C2H2 454 476 2.12e-4 SMART
ZnF_C2H2 482 504 1.04e-3 SMART
ZnF_C2H2 510 532 2.95e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109131
AA Change: F408L

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104759
Gene: ENSMUSG00000048728
AA Change: F408L

DomainStartEndE-ValueType
ZnF_C2H2 80 102 9.73e-4 SMART
ZnF_C2H2 119 141 6.32e-3 SMART
ZnF_C2H2 147 169 2.4e-3 SMART
ZnF_C2H2 175 197 8.22e-2 SMART
ZnF_C2H2 203 225 1.33e-1 SMART
ZnF_C2H2 231 253 1.84e-4 SMART
ZnF_C2H2 259 281 9.73e-4 SMART
ZnF_C2H2 287 309 5.21e-4 SMART
ZnF_C2H2 315 337 4.87e-4 SMART
ZnF_C2H2 343 365 2.12e-4 SMART
ZnF_C2H2 371 393 1.04e-3 SMART
ZnF_C2H2 399 421 2.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125749
SMART Domains Protein: ENSMUSP00000122658
Gene: ENSMUSG00000048728

DomainStartEndE-ValueType
KRAB 14 75 1.35e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126718
Predicted Effect probably benign
Transcript: ENSMUST00000163301
AA Change: F519L

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129125
Gene: ENSMUSG00000048728
AA Change: F519L

DomainStartEndE-ValueType
KRAB 14 75 1.35e-29 SMART
ZnF_C2H2 191 213 9.73e-4 SMART
ZnF_C2H2 230 252 6.32e-3 SMART
ZnF_C2H2 258 280 2.4e-3 SMART
ZnF_C2H2 286 308 8.22e-2 SMART
ZnF_C2H2 314 336 1.33e-1 SMART
ZnF_C2H2 342 364 1.84e-4 SMART
ZnF_C2H2 370 392 9.73e-4 SMART
ZnF_C2H2 398 420 5.21e-4 SMART
ZnF_C2H2 426 448 4.87e-4 SMART
ZnF_C2H2 454 476 2.12e-4 SMART
ZnF_C2H2 482 504 1.04e-3 SMART
ZnF_C2H2 510 532 2.95e-3 SMART
Meta Mutation Damage Score 0.6614 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,257,006 probably null Het
Actbl2 G T 13: 111,255,381 M83I probably damaging Het
Adgra2 T A 8: 27,114,162 M460K probably benign Het
Aldh16a1 G A 7: 45,149,765 A31V probably damaging Het
Ank2 T C 3: 126,946,938 probably benign Het
Arrdc4 C A 7: 68,749,045 D8Y probably benign Het
Auts2 A G 5: 131,466,115 Y110H probably damaging Het
Blnk A T 19: 40,934,459 Y405N probably damaging Het
Capsl T C 15: 9,461,769 F84L probably damaging Het
Cenpl T C 1: 161,074,895 S46P probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chrnd C T 1: 87,192,229 R90C probably damaging Het
Cyfip2 A T 11: 46,291,520 M37K probably benign Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Dnah5 T G 15: 28,372,411 V2936G probably damaging Het
Dock9 A G 14: 121,546,021 M2055T probably damaging Het
Epb41l2 A T 10: 25,468,128 R274S probably damaging Het
Erich3 A T 3: 154,727,502 H371L probably damaging Het
Evi5l C A 8: 4,203,080 P454T probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Golgb1 T A 16: 36,918,197 C2299* probably null Het
Heca G C 10: 17,915,243 probably null Het
Hecw1 C T 13: 14,522,829 A9T probably benign Het
Hs3st6 T A 17: 24,758,568 W341R probably damaging Het
Kidins220 C T 12: 25,057,534 S1571L probably benign Het
Klk9 A G 7: 43,794,308 E82G probably damaging Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Mecom A G 3: 29,980,592 Y502H probably damaging Het
Mfsd2a A G 4: 122,949,372 V372A probably benign Het
Mrgprd A G 7: 145,322,142 D250G probably benign Het
Muc2 A G 7: 141,700,828 D191G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr1312 A G 2: 112,042,768 V88A probably benign Het
Olfr692 A G 7: 105,368,902 Y192C probably damaging Het
Pnpla6 T C 8: 3,544,015 V1342A probably benign Het
Ppp1r9a A G 6: 5,115,151 E789G probably damaging Het
Prkdc A G 16: 15,714,919 T1471A probably benign Het
Scarb1 T A 5: 125,304,331 S50C probably damaging Het
Slc4a8 C T 15: 100,789,164 T283M probably damaging Het
Smc2 C A 4: 52,462,814 D601E probably benign Het
Snx6 C A 12: 54,752,013 V221F probably damaging Het
Spag17 A C 3: 100,088,427 K1794T probably benign Het
Tpo A G 12: 30,103,108 W416R probably damaging Het
Ttc13 C A 8: 124,683,191 K427N probably damaging Het
Upf3a A T 8: 13,787,466 N137I possibly damaging Het
Ush2a C T 1: 188,849,046 Q3708* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp451 A G 1: 33,813,735 F33L probably damaging Het
Zfp639 T C 3: 32,517,088 Y40H probably damaging Het
Other mutations in Zfp454
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Zfp454 APN 11 50874206 missense probably benign 0.22
IGL01631:Zfp454 APN 11 50883735 missense probably benign
R0109:Zfp454 UTSW 11 50883775 missense possibly damaging 0.71
R0606:Zfp454 UTSW 11 50874185 missense probably benign 0.00
R0743:Zfp454 UTSW 11 50873937 missense probably benign 0.01
R0884:Zfp454 UTSW 11 50873937 missense probably benign 0.01
R1181:Zfp454 UTSW 11 50873586 missense probably damaging 1.00
R1377:Zfp454 UTSW 11 50873780 missense probably damaging 1.00
R2126:Zfp454 UTSW 11 50873995 missense probably benign 0.44
R4869:Zfp454 UTSW 11 50873153 missense probably damaging 1.00
R4973:Zfp454 UTSW 11 50874123 missense probably benign
R5379:Zfp454 UTSW 11 50883802 missense probably damaging 0.99
R5997:Zfp454 UTSW 11 50873622 missense probably damaging 1.00
R6490:Zfp454 UTSW 11 50874123 missense probably benign
R6892:Zfp454 UTSW 11 50873198 missense probably damaging 1.00
R7362:Zfp454 UTSW 11 50886367 critical splice donor site probably null
R7650:Zfp454 UTSW 11 50883753 missense probably damaging 0.98
R8671:Zfp454 UTSW 11 50873768 missense possibly damaging 0.71
R9368:Zfp454 UTSW 11 50873710 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CCTGGCTCCGAGTAAATCCA -3'
(R):5'- AGGCCTTCTCAGTGAGCTCT -3'

Sequencing Primer
(F):5'- TGGCTCCGAGTAAATCCAACCATG -3'
(R):5'- CCCTTTGAATGCAACGAGTG -3'
Posted On 2018-04-02