Incidental Mutation 'R6321:Kidins220'
ID510358
Institutional Source Beutler Lab
Gene Symbol Kidins220
Ensembl Gene ENSMUSG00000036333
Gene Namekinase D-interacting substrate 220
SynonymsC330002I19Rik, 3110039L19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6321 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location24974925-25063152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25057534 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 1571 (S1571L)
Ref Sequence ENSEMBL: ENSMUSP00000152726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066652] [ENSMUST00000220459] [ENSMUST00000222941]
Predicted Effect probably benign
Transcript: ENSMUST00000066652
AA Change: S1692L

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000063999
Gene: ENSMUSG00000036333
AA Change: S1692L

DomainStartEndE-ValueType
ANK 37 66 1.11e-7 SMART
ANK 70 99 2.25e-3 SMART
ANK 103 132 4.78e-7 SMART
ANK 136 165 5.53e-3 SMART
ANK 169 198 2.52e-6 SMART
ANK 202 231 6.26e-2 SMART
ANK 235 264 1.22e-4 SMART
ANK 268 297 6.92e-4 SMART
ANK 301 330 1.57e-2 SMART
ANK 334 363 9.78e-4 SMART
ANK 367 398 4.6e0 SMART
Pfam:KAP_NTPase 440 953 1.2e-112 PFAM
low complexity region 1077 1092 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1382 1396 N/A INTRINSIC
low complexity region 1422 1452 N/A INTRINSIC
low complexity region 1509 1520 N/A INTRINSIC
low complexity region 1544 1555 N/A INTRINSIC
low complexity region 1561 1567 N/A INTRINSIC
low complexity region 1596 1609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220459
AA Change: S1571L

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221622
Predicted Effect probably benign
Transcript: ENSMUST00000222013
Predicted Effect probably benign
Transcript: ENSMUST00000222481
Predicted Effect probably benign
Transcript: ENSMUST00000222941
AA Change: S1662L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is preferentially expressed in the nervous system where it controls neuronal cell survival, differentiation into exons and dendrites, and synaptic plasticity. The encoded protein interacts with membrane receptors, cytosolic signaling components, and cytoskeletal proteins, serving as a scaffold that mediates crosstalk between the neurotrophin pathway and several other intracellular signaling pathways. Aberrant expression of this gene is associated with the onset of various neuropsychiatric disorders and neurodegenerative diseases, including Alzheimer's disease. Naturally occurring mutations in this gene are associated with a syndrome characterized by spastic paraplegia, intellectual disability, nystagmus and obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for a knock-out allele exhibit decreased dendritic complexity in the barrel somatosensory cortex and dentate gyrus neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,257,006 probably null Het
Actbl2 G T 13: 111,255,381 M83I probably damaging Het
Adgra2 T A 8: 27,114,162 M460K probably benign Het
Aldh16a1 G A 7: 45,149,765 A31V probably damaging Het
Ank2 T C 3: 126,946,938 probably benign Het
Arrdc4 C A 7: 68,749,045 D8Y probably benign Het
Auts2 A G 5: 131,466,115 Y110H probably damaging Het
Blnk A T 19: 40,934,459 Y405N probably damaging Het
Capsl T C 15: 9,461,769 F84L probably damaging Het
Cenpl T C 1: 161,074,895 S46P probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chrnd C T 1: 87,192,229 R90C probably damaging Het
Cyfip2 A T 11: 46,291,520 M37K probably benign Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Dnah5 T G 15: 28,372,411 V2936G probably damaging Het
Dock9 A G 14: 121,546,021 M2055T probably damaging Het
Epb41l2 A T 10: 25,468,128 R274S probably damaging Het
Erich3 A T 3: 154,727,502 H371L probably damaging Het
Evi5l C A 8: 4,203,080 P454T probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Golgb1 T A 16: 36,918,197 C2299* probably null Het
Heca G C 10: 17,915,243 probably null Het
Hecw1 C T 13: 14,522,829 A9T probably benign Het
Hs3st6 T A 17: 24,758,568 W341R probably damaging Het
Klk9 A G 7: 43,794,308 E82G probably damaging Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Mecom A G 3: 29,980,592 Y502H probably damaging Het
Mfsd2a A G 4: 122,949,372 V372A probably benign Het
Mrgprd A G 7: 145,322,142 D250G probably benign Het
Muc2 A G 7: 141,700,828 D191G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr1312 A G 2: 112,042,768 V88A probably benign Het
Olfr692 A G 7: 105,368,902 Y192C probably damaging Het
Pnpla6 T C 8: 3,544,015 V1342A probably benign Het
Ppp1r9a A G 6: 5,115,151 E789G probably damaging Het
Prkdc A G 16: 15,714,919 T1471A probably benign Het
Scarb1 T A 5: 125,304,331 S50C probably damaging Het
Slc4a8 C T 15: 100,789,164 T283M probably damaging Het
Smc2 C A 4: 52,462,814 D601E probably benign Het
Snx6 C A 12: 54,752,013 V221F probably damaging Het
Spag17 A C 3: 100,088,427 K1794T probably benign Het
Tpo A G 12: 30,103,108 W416R probably damaging Het
Ttc13 C A 8: 124,683,191 K427N probably damaging Het
Upf3a A T 8: 13,787,466 N137I possibly damaging Het
Ush2a C T 1: 188,849,046 Q3708* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp451 A G 1: 33,813,735 F33L probably damaging Het
Zfp454 A G 11: 50,873,049 F408L probably damaging Het
Zfp639 T C 3: 32,517,088 Y40H probably damaging Het
Other mutations in Kidins220
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Kidins220 APN 12 25038560 splice site probably benign
IGL00959:Kidins220 APN 12 25051133 missense possibly damaging 0.74
IGL00978:Kidins220 APN 12 25057474 missense probably damaging 1.00
IGL01144:Kidins220 APN 12 25010926 missense probably damaging 1.00
IGL01326:Kidins220 APN 12 25038499 missense probably damaging 0.97
IGL01545:Kidins220 APN 12 25040460 missense possibly damaging 0.66
IGL01802:Kidins220 APN 12 24995000 missense probably damaging 1.00
IGL01875:Kidins220 APN 12 25057729 missense probably benign 0.00
IGL02160:Kidins220 APN 12 25004111 missense probably damaging 1.00
IGL02383:Kidins220 APN 12 24997333 splice site probably benign
IGL02673:Kidins220 APN 12 24994992 missense probably damaging 1.00
IGL02800:Kidins220 APN 12 25003093 missense probably damaging 1.00
IGL03345:Kidins220 APN 12 25003045 missense probably damaging 1.00
IGL03379:Kidins220 APN 12 25008448 missense probably damaging 0.99
IGL03412:Kidins220 APN 12 24999345 missense probably damaging 1.00
P0043:Kidins220 UTSW 12 25008156 missense probably damaging 1.00
R0011:Kidins220 UTSW 12 24999352 missense probably damaging 0.99
R0011:Kidins220 UTSW 12 24999352 missense probably damaging 0.99
R0269:Kidins220 UTSW 12 25040512 missense probably damaging 0.98
R0280:Kidins220 UTSW 12 25010141 missense probably damaging 1.00
R0334:Kidins220 UTSW 12 25008069 missense probably damaging 1.00
R1601:Kidins220 UTSW 12 25005088 missense probably benign 0.35
R1778:Kidins220 UTSW 12 25013446 splice site probably benign
R1808:Kidins220 UTSW 12 25003009 missense probably benign 0.00
R1855:Kidins220 UTSW 12 25056591 missense probably damaging 1.00
R1965:Kidins220 UTSW 12 24994906 missense probably damaging 1.00
R1982:Kidins220 UTSW 12 25051194 missense probably benign 0.01
R2069:Kidins220 UTSW 12 24987006 splice site probably benign
R2101:Kidins220 UTSW 12 25057423 missense probably damaging 1.00
R2124:Kidins220 UTSW 12 25041303 critical splice donor site probably null
R2371:Kidins220 UTSW 12 25057324 missense probably damaging 1.00
R2405:Kidins220 UTSW 12 25011509 missense probably damaging 0.99
R3522:Kidins220 UTSW 12 24990758 missense probably damaging 1.00
R3877:Kidins220 UTSW 12 25001565 splice site probably benign
R3915:Kidins220 UTSW 12 25053958 missense possibly damaging 0.93
R4023:Kidins220 UTSW 12 25057144 intron probably null
R4287:Kidins220 UTSW 12 25056846 missense possibly damaging 0.81
R4476:Kidins220 UTSW 12 25011001 missense probably damaging 1.00
R4495:Kidins220 UTSW 12 25038302 intron probably null
R4627:Kidins220 UTSW 12 25057042 missense possibly damaging 0.89
R4807:Kidins220 UTSW 12 25057285 missense probably damaging 1.00
R4899:Kidins220 UTSW 12 25013443 critical splice donor site probably null
R4960:Kidins220 UTSW 12 24992260 nonsense probably null
R5118:Kidins220 UTSW 12 24992297 missense probably damaging 1.00
R5183:Kidins220 UTSW 12 25051126 missense probably benign 0.17
R5238:Kidins220 UTSW 12 25003010 missense probably benign 0.31
R5580:Kidins220 UTSW 12 25047897 missense probably benign 0.00
R5707:Kidins220 UTSW 12 25013391 missense probably damaging 1.00
R5813:Kidins220 UTSW 12 25057140 nonsense probably null
R6131:Kidins220 UTSW 12 24992314 splice site probably null
R6146:Kidins220 UTSW 12 25052813 missense probably damaging 1.00
R6151:Kidins220 UTSW 12 25056909 missense possibly damaging 0.65
R6160:Kidins220 UTSW 12 24997311 missense probably damaging 1.00
R6187:Kidins220 UTSW 12 25051308 intron probably null
R6289:Kidins220 UTSW 12 25056616 missense probably damaging 1.00
R6450:Kidins220 UTSW 12 25057191 missense probably benign
R6513:Kidins220 UTSW 12 25038435 missense possibly damaging 0.94
R6652:Kidins220 UTSW 12 25010060 splice site probably null
R6711:Kidins220 UTSW 12 24998751 missense probably damaging 0.96
R6858:Kidins220 UTSW 12 25008543 missense possibly damaging 0.85
R7102:Kidins220 UTSW 12 25057663 missense probably benign 0.00
R7112:Kidins220 UTSW 12 25004019 missense probably damaging 1.00
R7139:Kidins220 UTSW 12 24994821 missense probably damaging 1.00
R7140:Kidins220 UTSW 12 25036624 missense probably damaging 1.00
R7271:Kidins220 UTSW 12 25011571 missense probably benign 0.21
R7361:Kidins220 UTSW 12 25057000 missense probably benign 0.01
R7509:Kidins220 UTSW 12 24982361 missense probably damaging 0.98
R7510:Kidins220 UTSW 12 24992269 missense possibly damaging 0.88
R7783:Kidins220 UTSW 12 24988556 missense probably damaging 1.00
R7796:Kidins220 UTSW 12 24982351 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CACTCTCTCCACAATGAGGCAG -3'
(R):5'- TCAGGTTTTCATTCTGCACAGC -3'

Sequencing Primer
(F):5'- TGACTCCCAGCTGGAAAAGGC -3'
(R):5'- CACAGCAGTTGGGTTGGGAC -3'
Posted On2018-04-02