Incidental Mutation 'R6321:Tpo'
ID 510359
Institutional Source Beutler Lab
Gene Symbol Tpo
Ensembl Gene ENSMUSG00000020673
Gene Name thyroid peroxidase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.509) question?
Stock # R6321 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 30054659-30132624 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30103108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 416 (W416R)
Ref Sequence ENSEMBL: ENSMUSP00000021005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021005]
AlphaFold P35419
Predicted Effect probably damaging
Transcript: ENSMUST00000021005
AA Change: W416R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021005
Gene: ENSMUSG00000020673
AA Change: W416R

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:An_peroxidase 145 697 4.2e-180 PFAM
CCP 730 782 1.26e-7 SMART
EGF_CA 784 827 3.51e-10 SMART
transmembrane domain 837 859 N/A INTRINSIC
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: This gene encodes a membrane-bound glycoprotein. The encoded enzyme plays a central role in thyroid gland function. The enzyme functions in the iodination of tyrosine residues in thyroglobulin and phenoxy-ester formation between pairs of iodinated tyrosines to generate the thyroid hormones, thyroxine and triiodothyronine. Mice with homozygous missense mutations in this gene exhibit hypothyroid dwarfism and hearing impairment. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mice with a missense mutation exhibit hypothyroid dwarfism, including a goiter with colloid deficiency and abnormal follicle epithelium, reduced hematocrit and red blood cells and a lifespan of about 3 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,257,006 probably null Het
Actbl2 G T 13: 111,255,381 M83I probably damaging Het
Adgra2 T A 8: 27,114,162 M460K probably benign Het
Aldh16a1 G A 7: 45,149,765 A31V probably damaging Het
Ank2 T C 3: 126,946,938 probably benign Het
Arrdc4 C A 7: 68,749,045 D8Y probably benign Het
Auts2 A G 5: 131,466,115 Y110H probably damaging Het
Blnk A T 19: 40,934,459 Y405N probably damaging Het
Capsl T C 15: 9,461,769 F84L probably damaging Het
Cenpl T C 1: 161,074,895 S46P probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chrnd C T 1: 87,192,229 R90C probably damaging Het
Cyfip2 A T 11: 46,291,520 M37K probably benign Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Dnah5 T G 15: 28,372,411 V2936G probably damaging Het
Dock9 A G 14: 121,546,021 M2055T probably damaging Het
Epb41l2 A T 10: 25,468,128 R274S probably damaging Het
Erich3 A T 3: 154,727,502 H371L probably damaging Het
Evi5l C A 8: 4,203,080 P454T probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Golgb1 T A 16: 36,918,197 C2299* probably null Het
Heca G C 10: 17,915,243 probably null Het
Hecw1 C T 13: 14,522,829 A9T probably benign Het
Hs3st6 T A 17: 24,758,568 W341R probably damaging Het
Kidins220 C T 12: 25,057,534 S1571L probably benign Het
Klk9 A G 7: 43,794,308 E82G probably damaging Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Mecom A G 3: 29,980,592 Y502H probably damaging Het
Mfsd2a A G 4: 122,949,372 V372A probably benign Het
Mrgprd A G 7: 145,322,142 D250G probably benign Het
Muc2 A G 7: 141,700,828 D191G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr1312 A G 2: 112,042,768 V88A probably benign Het
Olfr692 A G 7: 105,368,902 Y192C probably damaging Het
Pnpla6 T C 8: 3,544,015 V1342A probably benign Het
Ppp1r9a A G 6: 5,115,151 E789G probably damaging Het
Prkdc A G 16: 15,714,919 T1471A probably benign Het
Scarb1 T A 5: 125,304,331 S50C probably damaging Het
Slc4a8 C T 15: 100,789,164 T283M probably damaging Het
Smc2 C A 4: 52,462,814 D601E probably benign Het
Snx6 C A 12: 54,752,013 V221F probably damaging Het
Spag17 A C 3: 100,088,427 K1794T probably benign Het
Ttc13 C A 8: 124,683,191 K427N probably damaging Het
Upf3a A T 8: 13,787,466 N137I possibly damaging Het
Ush2a C T 1: 188,849,046 Q3708* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp451 A G 1: 33,813,735 F33L probably damaging Het
Zfp454 A G 11: 50,873,049 F408L probably damaging Het
Zfp639 T C 3: 32,517,088 Y40H probably damaging Het
Other mutations in Tpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Tpo APN 12 30084620 missense probably damaging 1.00
IGL00694:Tpo APN 12 30105994 missense probably damaging 0.98
IGL01660:Tpo APN 12 30119400 splice site probably benign
IGL01939:Tpo APN 12 30084647 missense possibly damaging 0.83
IGL02624:Tpo APN 12 30100414 missense probably benign 0.40
IGL03268:Tpo APN 12 30094965 missense possibly damaging 0.82
IGL03330:Tpo APN 12 30103501 missense probably damaging 0.97
IGL03138:Tpo UTSW 12 30074171 missense probably benign 0.00
R0025:Tpo UTSW 12 30100390 missense probably benign 0.03
R0025:Tpo UTSW 12 30100390 missense probably benign 0.03
R0076:Tpo UTSW 12 30104023 missense probably damaging 1.00
R0472:Tpo UTSW 12 30100486 missense probably benign 0.03
R1389:Tpo UTSW 12 30103110 missense probably damaging 0.98
R1493:Tpo UTSW 12 30131809 missense possibly damaging 0.78
R1526:Tpo UTSW 12 30084695 missense probably damaging 0.99
R1674:Tpo UTSW 12 30100568 missense probably benign 0.16
R1689:Tpo UTSW 12 30098246 missense probably damaging 1.00
R1986:Tpo UTSW 12 30119466 missense probably damaging 1.00
R2381:Tpo UTSW 12 30131827 missense possibly damaging 0.67
R2484:Tpo UTSW 12 30103969 missense probably benign 0.12
R2902:Tpo UTSW 12 30119449 missense possibly damaging 0.91
R4105:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4106:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4107:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4108:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4109:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4374:Tpo UTSW 12 30103152 missense possibly damaging 0.50
R4425:Tpo UTSW 12 30104016 missense probably damaging 1.00
R4600:Tpo UTSW 12 30098229 missense probably benign 0.32
R4668:Tpo UTSW 12 30103290 missense probably benign 0.03
R4758:Tpo UTSW 12 30075871 missense probably damaging 1.00
R4838:Tpo UTSW 12 30092634 missense probably damaging 1.00
R4869:Tpo UTSW 12 30103365 missense probably benign 0.00
R5163:Tpo UTSW 12 30105980 missense probably benign 0.00
R5223:Tpo UTSW 12 30092590 missense probably damaging 0.99
R5367:Tpo UTSW 12 30103290 missense probably damaging 1.00
R5658:Tpo UTSW 12 30055138 missense possibly damaging 0.95
R5660:Tpo UTSW 12 30100496 missense possibly damaging 0.92
R5671:Tpo UTSW 12 30119491 missense probably benign 0.00
R6019:Tpo UTSW 12 30094981 missense possibly damaging 0.94
R6074:Tpo UTSW 12 30078187 missense probably benign 0.15
R6181:Tpo UTSW 12 30131885 missense probably benign 0.37
R6433:Tpo UTSW 12 30084754 missense probably benign
R7206:Tpo UTSW 12 30103134 missense possibly damaging 0.76
R7234:Tpo UTSW 12 30092686 missense probably benign 0.00
R7473:Tpo UTSW 12 30092590 missense probably benign 0.15
R7571:Tpo UTSW 12 30119432 missense probably benign 0.00
R7709:Tpo UTSW 12 30131860 missense possibly damaging 0.62
R7844:Tpo UTSW 12 30100405 missense probably damaging 1.00
R7859:Tpo UTSW 12 30100574 missense probably damaging 1.00
R7883:Tpo UTSW 12 30103170 missense probably damaging 1.00
R8138:Tpo UTSW 12 30074104 missense probably benign 0.00
R8171:Tpo UTSW 12 30104046 missense probably damaging 1.00
R8726:Tpo UTSW 12 30055138 missense possibly damaging 0.95
R8877:Tpo UTSW 12 30092739 missense probably damaging 0.99
R9400:Tpo UTSW 12 30119442 missense possibly damaging 0.94
X0050:Tpo UTSW 12 30078094 missense probably damaging 1.00
Z1088:Tpo UTSW 12 30094782 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAAGAAAGCCCATGGTGG -3'
(R):5'- TGCTGCGTGTCAACACTCTC -3'

Sequencing Primer
(F):5'- TGGTGGTCCCACTGGATACTC -3'
(R):5'- GTGTCAACACTCTCCACCTAGATG -3'
Posted On 2018-04-02