Mutagenetix > Incidental Mutation

Incidental Mutation 'R6321:Tpo'

510359

Institutional Source

Beutler Lab

Gene Symbol

Tpo

Ensembl Gene

ENSMUSG00000020673

Gene Name

thyroid peroxidase

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.423) question?

Stock #

R6321 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30054659-30132624 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30103108 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 416 (W416R)

Ref Sequence

ENSEMBL: ENSMUSP00000021005 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021005]

AlphaFold

P35419

Predicted Effect

probably damaging
Transcript: ENSMUST00000021005
AA Change: W416R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000021005
Gene: ENSMUSG00000020673
AA Change: W416R

Domain	Start	End	E-Value	Type
transmembrane domain	5	24	N/A	INTRINSIC
Pfam:An_peroxidase	145	697	4.2e-180	PFAM
CCP	730	782	1.26e-7	SMART
EGF_CA	784	827	3.51e-10	SMART
transmembrane domain	837	859	N/A	INTRINSIC

Meta Mutation Damage Score

0.9496

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: This gene encodes a membrane-bound glycoprotein. The encoded enzyme plays a central role in thyroid gland function. The enzyme functions in the iodination of tyrosine residues in thyroglobulin and phenoxy-ester formation between pairs of iodinated tyrosines to generate the thyroid hormones, thyroxine and triiodothyronine. Mice with homozygous missense mutations in this gene exhibit hypothyroid dwarfism and hearing impairment. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mice with a missense mutation exhibit hypothyroid dwarfism, including a goiter with colloid deficiency and abnormal follicle epithelium, reduced hematocrit and red blood cells and a lifespan of about 3 months. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	T	C	7: 131,257,006		probably null	Het
Actbl2	G	T	13: 111,255,381	M83I	probably damaging	Het
Adgra2	T	A	8: 27,114,162	M460K	probably benign	Het
Aldh16a1	G	A	7: 45,149,765	A31V	probably damaging	Het
Ank2	T	C	3: 126,946,938		probably benign	Het
Arrdc4	C	A	7: 68,749,045	D8Y	probably benign	Het
Auts2	A	G	5: 131,466,115	Y110H	probably damaging	Het
Blnk	A	T	19: 40,934,459	Y405N	probably damaging	Het
Capsl	T	C	15: 9,461,769	F84L	probably damaging	Het
Cenpl	T	C	1: 161,074,895	S46P	probably benign	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Chrnd	C	T	1: 87,192,229	R90C	probably damaging	Het
Cyfip2	A	T	11: 46,291,520	M37K	probably benign	Het
Dnah11	T	C	12: 118,142,292	E625G	possibly damaging	Het
Dnah5	T	G	15: 28,372,411	V2936G	probably damaging	Het
Dock9	A	G	14: 121,546,021	M2055T	probably damaging	Het
Epb41l2	A	T	10: 25,468,128	R274S	probably damaging	Het
Erich3	A	T	3: 154,727,502	H371L	probably damaging	Het
Evi5l	C	A	8: 4,203,080	P454T	probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Golgb1	T	A	16: 36,918,197	C2299*	probably null	Het
Heca	G	C	10: 17,915,243		probably null	Het
Hecw1	C	T	13: 14,522,829	A9T	probably benign	Het
Hs3st6	T	A	17: 24,758,568	W341R	probably damaging	Het
Kidins220	C	T	12: 25,057,534	S1571L	probably benign	Het
Klk9	A	G	7: 43,794,308	E82G	probably damaging	Het
Ltbp3	C	A	19: 5,745,657	H180Q	probably benign	Het
Mecom	A	G	3: 29,980,592	Y502H	probably damaging	Het
Mfsd2a	A	G	4: 122,949,372	V372A	probably benign	Het
Mrgprd	A	G	7: 145,322,142	D250G	probably benign	Het
Muc2	A	G	7: 141,700,828	D191G	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naip6	C	A	13: 100,300,401	S538I	probably benign	Het
Olfr1312	A	G	2: 112,042,768	V88A	probably benign	Het
Olfr692	A	G	7: 105,368,902	Y192C	probably damaging	Het
Pnpla6	T	C	8: 3,544,015	V1342A	probably benign	Het
Ppp1r9a	A	G	6: 5,115,151	E789G	probably damaging	Het
Prkdc	A	G	16: 15,714,919	T1471A	probably benign	Het
Scarb1	T	A	5: 125,304,331	S50C	probably damaging	Het
Slc4a8	C	T	15: 100,789,164	T283M	probably damaging	Het
Smc2	C	A	4: 52,462,814	D601E	probably benign	Het
Snx6	C	A	12: 54,752,013	V221F	probably damaging	Het
Spag17	A	C	3: 100,088,427	K1794T	probably benign	Het
Ttc13	C	A	8: 124,683,191	K427N	probably damaging	Het
Upf3a	A	T	8: 13,787,466	N137I	possibly damaging	Het
Ush2a	C	T	1: 188,849,046	Q3708*	probably null	Het
Zbtb17	G	A	4: 141,463,383	G171S	probably benign	Het
Zfp451	A	G	1: 33,813,735	F33L	probably damaging	Het
Zfp454	A	G	11: 50,873,049	F408L	probably damaging	Het
Zfp639	T	C	3: 32,517,088	Y40H	probably damaging	Het

Other mutations in Tpo

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Tpo	APN	12	30084620	missense	probably damaging	1.00
IGL00694:Tpo	APN	12	30105994	missense	probably damaging	0.98
IGL01660:Tpo	APN	12	30119400	splice site	probably benign
IGL01939:Tpo	APN	12	30084647	missense	possibly damaging	0.83
IGL02624:Tpo	APN	12	30100414	missense	probably benign	0.40
IGL03268:Tpo	APN	12	30094965	missense	possibly damaging	0.82
IGL03330:Tpo	APN	12	30103501	missense	probably damaging	0.97
IGL03138:Tpo	UTSW	12	30074171	missense	probably benign	0.00
R0025:Tpo	UTSW	12	30100390	missense	probably benign	0.03
R0025:Tpo	UTSW	12	30100390	missense	probably benign	0.03
R0076:Tpo	UTSW	12	30104023	missense	probably damaging	1.00
R0472:Tpo	UTSW	12	30100486	missense	probably benign	0.03
R1389:Tpo	UTSW	12	30103110	missense	probably damaging	0.98
R1493:Tpo	UTSW	12	30131809	missense	possibly damaging	0.78
R1526:Tpo	UTSW	12	30084695	missense	probably damaging	0.99
R1674:Tpo	UTSW	12	30100568	missense	probably benign	0.16
R1689:Tpo	UTSW	12	30098246	missense	probably damaging	1.00
R1986:Tpo	UTSW	12	30119466	missense	probably damaging	1.00
R2381:Tpo	UTSW	12	30131827	missense	possibly damaging	0.67
R2484:Tpo	UTSW	12	30103969	missense	probably benign	0.12
R2902:Tpo	UTSW	12	30119449	missense	possibly damaging	0.91
R4105:Tpo	UTSW	12	30092586	missense	probably damaging	0.98
R4106:Tpo	UTSW	12	30092586	missense	probably damaging	0.98
R4107:Tpo	UTSW	12	30092586	missense	probably damaging	0.98
R4108:Tpo	UTSW	12	30092586	missense	probably damaging	0.98
R4109:Tpo	UTSW	12	30092586	missense	probably damaging	0.98
R4374:Tpo	UTSW	12	30103152	missense	possibly damaging	0.50
R4425:Tpo	UTSW	12	30104016	missense	probably damaging	1.00
R4600:Tpo	UTSW	12	30098229	missense	probably benign	0.32
R4668:Tpo	UTSW	12	30103290	missense	probably benign	0.03
R4758:Tpo	UTSW	12	30075871	missense	probably damaging	1.00
R4838:Tpo	UTSW	12	30092634	missense	probably damaging	1.00
R4869:Tpo	UTSW	12	30103365	missense	probably benign	0.00
R5163:Tpo	UTSW	12	30105980	missense	probably benign	0.00
R5223:Tpo	UTSW	12	30092590	missense	probably damaging	0.99
R5367:Tpo	UTSW	12	30103290	missense	probably damaging	1.00
R5658:Tpo	UTSW	12	30055138	missense	possibly damaging	0.95
R5660:Tpo	UTSW	12	30100496	missense	possibly damaging	0.92
R5671:Tpo	UTSW	12	30119491	missense	probably benign	0.00
R6019:Tpo	UTSW	12	30094981	missense	possibly damaging	0.94
R6074:Tpo	UTSW	12	30078187	missense	probably benign	0.15
R6181:Tpo	UTSW	12	30131885	missense	probably benign	0.37
R6433:Tpo	UTSW	12	30084754	missense	probably benign
R7206:Tpo	UTSW	12	30103134	missense	possibly damaging	0.76
R7234:Tpo	UTSW	12	30092686	missense	probably benign	0.00
R7473:Tpo	UTSW	12	30092590	missense	probably benign	0.15
R7571:Tpo	UTSW	12	30119432	missense	probably benign	0.00
R7709:Tpo	UTSW	12	30131860	missense	possibly damaging	0.62
R7844:Tpo	UTSW	12	30100405	missense	probably damaging	1.00
R7859:Tpo	UTSW	12	30100574	missense	probably damaging	1.00
R7883:Tpo	UTSW	12	30103170	missense	probably damaging	1.00
R8138:Tpo	UTSW	12	30074104	missense	probably benign	0.00
R8171:Tpo	UTSW	12	30104046	missense	probably damaging	1.00
R8726:Tpo	UTSW	12	30055138	missense	possibly damaging	0.95
R8877:Tpo	UTSW	12	30092739	missense	probably damaging	0.99
R9400:Tpo	UTSW	12	30119442	missense	possibly damaging	0.94
R9649:Tpo	UTSW	12	30075876	missense	probably damaging	1.00
X0050:Tpo	UTSW	12	30078094	missense	probably damaging	1.00
Z1088:Tpo	UTSW	12	30094782	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTAAGAAAGCCCATGGTGG -3'
(R):5'- TGCTGCGTGTCAACACTCTC -3'

Sequencing Primer
(F):5'- TGGTGGTCCCACTGGATACTC -3'
(R):5'- GTGTCAACACTCTCCACCTAGATG -3'

Posted On

2018-04-02