Incidental Mutation 'R6321:Dock9'
ID 510365
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, B230309H04Rik, Zizimin1
MMRRC Submission 044418-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6321 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 121779458-122035249 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121783433 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 2055 (M2055T)
Ref Sequence ENSEMBL: ENSMUSP00000047881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376] [ENSMUST00000212416]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000040700
AA Change: M2055T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: M2055T

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100299
AA Change: M2000T

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: M2000T

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211803
Predicted Effect possibly damaging
Transcript: ENSMUST00000212181
AA Change: M2030T

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000212376
AA Change: M2022T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000212416
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 G T 13: 111,391,915 (GRCm39) M83I probably damaging Het
Adgra2 T A 8: 27,604,190 (GRCm39) M460K probably benign Het
Aldh16a1 G A 7: 44,799,189 (GRCm39) A31V probably damaging Het
Ank2 T C 3: 126,740,587 (GRCm39) probably benign Het
Arrdc4 C A 7: 68,398,793 (GRCm39) D8Y probably benign Het
Auts2 A G 5: 131,494,953 (GRCm39) Y110H probably damaging Het
Blnk A T 19: 40,922,903 (GRCm39) Y405N probably damaging Het
Capsl T C 15: 9,461,855 (GRCm39) F84L probably damaging Het
Cdcp3 T C 7: 130,858,735 (GRCm39) probably null Het
Cenpl T C 1: 160,902,465 (GRCm39) S46P probably benign Het
Chd1l G A 3: 97,494,483 (GRCm39) A399V probably damaging Het
Chrnd C T 1: 87,119,951 (GRCm39) R90C probably damaging Het
Cyfip2 A T 11: 46,182,347 (GRCm39) M37K probably benign Het
Dnah11 T C 12: 118,106,027 (GRCm39) E625G possibly damaging Het
Dnah5 T G 15: 28,372,557 (GRCm39) V2936G probably damaging Het
Epb41l2 A T 10: 25,344,026 (GRCm39) R274S probably damaging Het
Erich3 A T 3: 154,433,139 (GRCm39) H371L probably damaging Het
Evi5l C A 8: 4,253,080 (GRCm39) P454T probably benign Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Golgb1 T A 16: 36,738,559 (GRCm39) C2299* probably null Het
Heca G C 10: 17,790,991 (GRCm39) probably null Het
Hecw1 C T 13: 14,697,414 (GRCm39) A9T probably benign Het
Hs3st6 T A 17: 24,977,542 (GRCm39) W341R probably damaging Het
Kidins220 C T 12: 25,107,533 (GRCm39) S1571L probably benign Het
Klk1b9 A G 7: 43,443,732 (GRCm39) E82G probably damaging Het
Ltbp3 C A 19: 5,795,685 (GRCm39) H180Q probably benign Het
Mecom A G 3: 30,034,741 (GRCm39) Y502H probably damaging Het
Mfsd2a A G 4: 122,843,165 (GRCm39) V372A probably benign Het
Mrgprd A G 7: 144,875,879 (GRCm39) D250G probably benign Het
Muc2 A G 7: 141,287,397 (GRCm39) D191G probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Naip6 C A 13: 100,436,909 (GRCm39) S538I probably benign Het
Or4f59 A G 2: 111,873,113 (GRCm39) V88A probably benign Het
Or52w1 A G 7: 105,018,109 (GRCm39) Y192C probably damaging Het
Pnpla6 T C 8: 3,594,015 (GRCm39) V1342A probably benign Het
Ppp1r9a A G 6: 5,115,151 (GRCm39) E789G probably damaging Het
Prkdc A G 16: 15,532,783 (GRCm39) T1471A probably benign Het
Scarb1 T A 5: 125,381,395 (GRCm39) S50C probably damaging Het
Slc4a8 C T 15: 100,687,045 (GRCm39) T283M probably damaging Het
Smc2 C A 4: 52,462,814 (GRCm39) D601E probably benign Het
Snx6 C A 12: 54,798,798 (GRCm39) V221F probably damaging Het
Spag17 A C 3: 99,995,743 (GRCm39) K1794T probably benign Het
Tpo A G 12: 30,153,107 (GRCm39) W416R probably damaging Het
Ttc13 C A 8: 125,409,930 (GRCm39) K427N probably damaging Het
Upf3a A T 8: 13,837,466 (GRCm39) N137I possibly damaging Het
Ush2a C T 1: 188,581,243 (GRCm39) Q3708* probably null Het
Zbtb17 G A 4: 141,190,694 (GRCm39) G171S probably benign Het
Zfp451 A G 1: 33,852,816 (GRCm39) F33L probably damaging Het
Zfp454 A G 11: 50,763,876 (GRCm39) F408L probably damaging Het
Zfp639 T C 3: 32,571,237 (GRCm39) Y40H probably damaging Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121,905,880 (GRCm39) missense probably benign 0.12
IGL00817:Dock9 APN 14 121,935,703 (GRCm39) missense probably damaging 0.96
IGL00923:Dock9 APN 14 121,844,504 (GRCm39) unclassified probably benign
IGL01385:Dock9 APN 14 121,817,995 (GRCm39) missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121,890,496 (GRCm39) missense probably damaging 1.00
IGL01767:Dock9 APN 14 121,860,282 (GRCm39) missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121,796,440 (GRCm39) missense probably damaging 1.00
IGL02512:Dock9 APN 14 121,856,950 (GRCm39) splice site probably benign
IGL02525:Dock9 APN 14 121,877,538 (GRCm39) missense probably damaging 1.00
IGL02550:Dock9 APN 14 121,935,724 (GRCm39) start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121,862,559 (GRCm39) splice site probably benign
IGL02666:Dock9 APN 14 121,818,111 (GRCm39) missense probably benign 0.42
IGL02674:Dock9 APN 14 121,833,023 (GRCm39) splice site probably null
IGL02795:Dock9 APN 14 121,877,390 (GRCm39) missense probably benign 0.04
IGL03074:Dock9 APN 14 121,844,682 (GRCm39) missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121,876,940 (GRCm39) missense probably damaging 1.00
IGL03294:Dock9 APN 14 121,879,035 (GRCm39) splice site probably benign
R0036:Dock9 UTSW 14 121,860,265 (GRCm39) missense probably damaging 1.00
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0270:Dock9 UTSW 14 121,813,411 (GRCm39) missense probably benign 0.02
R0494:Dock9 UTSW 14 121,899,996 (GRCm39) missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121,889,180 (GRCm39) nonsense probably null
R1029:Dock9 UTSW 14 121,837,096 (GRCm39) splice site probably null
R1214:Dock9 UTSW 14 121,823,728 (GRCm39) missense probably benign 0.02
R1231:Dock9 UTSW 14 121,813,362 (GRCm39) missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121,783,476 (GRCm39) missense probably damaging 1.00
R1629:Dock9 UTSW 14 121,780,986 (GRCm39) missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121,889,187 (GRCm39) missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121,864,292 (GRCm39) missense probably benign 0.01
R1772:Dock9 UTSW 14 121,847,210 (GRCm39) missense probably benign 0.07
R1855:Dock9 UTSW 14 121,877,571 (GRCm39) missense probably damaging 1.00
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1901:Dock9 UTSW 14 121,862,565 (GRCm39) splice site probably null
R1920:Dock9 UTSW 14 121,820,792 (GRCm39) missense probably damaging 1.00
R1987:Dock9 UTSW 14 121,829,242 (GRCm39) missense probably benign 0.00
R3035:Dock9 UTSW 14 121,844,249 (GRCm39) missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121,866,498 (GRCm39) splice site probably null
R4020:Dock9 UTSW 14 121,844,267 (GRCm39) missense probably benign 0.00
R4021:Dock9 UTSW 14 121,864,324 (GRCm39) missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121,820,883 (GRCm39) missense probably damaging 1.00
R4258:Dock9 UTSW 14 121,818,854 (GRCm39) missense probably benign 0.00
R4423:Dock9 UTSW 14 121,799,465 (GRCm39) critical splice donor site probably null
R4561:Dock9 UTSW 14 121,796,419 (GRCm39) missense probably benign 0.01
R4604:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R4646:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4647:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4776:Dock9 UTSW 14 121,847,509 (GRCm39) missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121,784,008 (GRCm39) missense probably benign 0.37
R4865:Dock9 UTSW 14 121,780,917 (GRCm39) makesense probably null
R4951:Dock9 UTSW 14 121,890,547 (GRCm39) missense probably benign 0.35
R5151:Dock9 UTSW 14 121,815,582 (GRCm39) missense probably damaging 1.00
R5359:Dock9 UTSW 14 121,890,472 (GRCm39) missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121,815,615 (GRCm39) missense probably damaging 1.00
R5502:Dock9 UTSW 14 121,847,594 (GRCm39) splice site probably null
R5579:Dock9 UTSW 14 121,837,107 (GRCm39) missense probably damaging 1.00
R5753:Dock9 UTSW 14 121,872,037 (GRCm39) missense probably benign 0.05
R5836:Dock9 UTSW 14 121,918,763 (GRCm39) missense probably damaging 1.00
R5858:Dock9 UTSW 14 121,866,204 (GRCm39) missense probably benign 0.00
R5890:Dock9 UTSW 14 121,905,820 (GRCm39) critical splice donor site probably null
R6075:Dock9 UTSW 14 121,783,385 (GRCm39) missense probably benign
R6298:Dock9 UTSW 14 121,872,006 (GRCm39) missense probably damaging 1.00
R6306:Dock9 UTSW 14 121,799,492 (GRCm39) missense probably damaging 1.00
R6330:Dock9 UTSW 14 121,842,655 (GRCm39) start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121,847,439 (GRCm39) missense probably damaging 1.00
R6784:Dock9 UTSW 14 121,780,926 (GRCm39) missense probably damaging 1.00
R6826:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6830:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6838:Dock9 UTSW 14 121,784,008 (GRCm39) missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121,823,676 (GRCm39) missense probably benign 0.37
R6919:Dock9 UTSW 14 121,880,564 (GRCm39) missense probably benign 0.42
R6989:Dock9 UTSW 14 121,864,791 (GRCm39) missense probably damaging 1.00
R7539:Dock9 UTSW 14 121,818,848 (GRCm39) missense probably damaging 1.00
R7645:Dock9 UTSW 14 121,835,075 (GRCm39) missense probably benign 0.44
R7875:Dock9 UTSW 14 121,863,396 (GRCm39) nonsense probably null
R7900:Dock9 UTSW 14 121,783,491 (GRCm39) missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121,889,206 (GRCm39) missense probably benign 0.06
R8420:Dock9 UTSW 14 121,783,454 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,918,847 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,864,801 (GRCm39) missense probably benign 0.40
R8514:Dock9 UTSW 14 121,896,199 (GRCm39) missense probably benign 0.25
R8691:Dock9 UTSW 14 121,877,517 (GRCm39) missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121,842,595 (GRCm39) missense probably damaging 0.98
R8894:Dock9 UTSW 14 121,860,373 (GRCm39) missense probably benign 0.10
R8900:Dock9 UTSW 14 121,817,940 (GRCm39) missense probably damaging 1.00
R9069:Dock9 UTSW 14 121,866,324 (GRCm39) missense probably damaging 0.98
R9218:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R9233:Dock9 UTSW 14 121,820,781 (GRCm39) missense probably benign 0.09
R9236:Dock9 UTSW 14 121,876,970 (GRCm39) missense probably damaging 1.00
R9285:Dock9 UTSW 14 121,833,012 (GRCm39) missense probably benign
R9451:Dock9 UTSW 14 121,787,601 (GRCm39) splice site probably benign
R9461:Dock9 UTSW 14 121,842,601 (GRCm39) missense probably benign 0.05
R9484:Dock9 UTSW 14 121,818,844 (GRCm39) missense probably damaging 1.00
R9517:Dock9 UTSW 14 121,829,236 (GRCm39) missense probably benign 0.07
R9542:Dock9 UTSW 14 121,864,775 (GRCm39) missense probably damaging 1.00
R9694:Dock9 UTSW 14 121,818,791 (GRCm39) missense probably damaging 1.00
R9701:Dock9 UTSW 14 121,876,983 (GRCm39) missense probably benign 0.01
R9703:Dock9 UTSW 14 121,781,989 (GRCm39) makesense probably null
R9726:Dock9 UTSW 14 121,835,149 (GRCm39) missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121,877,516 (GRCm39) missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121,792,687 (GRCm39) missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121,889,194 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTACGTTACACTTTCTCTCAGAG -3'
(R):5'- GAAAGTCATCTGTTTCTCTGCGG -3'

Sequencing Primer
(F):5'- CAGAGATGATAATTCTGGACTACTGG -3'
(R):5'- GAGCTCACACACAGTGTTTG -3'
Posted On 2018-04-02